Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TNRC6A cdna clone

TNRC6A cDNA Clone

Gene Names
TNRC6A; GW1; GW182; TNRC6; CAGH26
Synonyms
TNRC6A; TNRC6A cDNA Clone; TNRC6A cdna clone
Ordering
For Research Use Only!
Sequence
atgcagcacggcccgctgatcacattccacctgaacctccctcacggaaatgctctggtccgctacagttcaaaagaagaggtagtgaaggcacaaaagtctctgcacatgtgtgtactggggaacactactattcttgctgagtttgccagtgaagaggagatcagtcgtttctttgcacaaagccagtctctgaccccttctcccggctggcagtctctcgggtccagccagagccggctgggctccctcgactgttcccactcattctccagccggaccgatctcaatcactggaatggtgctgggctgtcgggaactaactgtggagaccttcacggcacttcactctgggggaccccgcattattccacaagcctgtggggtcccccaagcagcagcgacccccgaggaattagcagcccatctcccattaacgcttttctttctgttgaccacctgggtgggggtggagagtccatgtaa
Sequence Length
486
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
205,151 Da
NCBI Official Full Name
Homo sapiens trinucleotide repeat containing 6A, mRNA
NCBI Official Synonym Full Names
trinucleotide repeat containing 6A
NCBI Official Symbol
TNRC6A
NCBI Official Synonym Symbols
GW1; GW182; TNRC6; CAGH26
NCBI Protein Information
trinucleotide repeat-containing gene 6A protein
UniProt Protein Name
Trinucleotide repeat-containing gene 6A protein
UniProt Gene Name
TNRC6A
UniProt Synonym Gene Names
CAGH26; KIAA1460; TNRC6; Protein GW1
UniProt Entry Name
TNR6A_HUMAN

NCBI Description

This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The protein associates with messenger RNAs and Argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies. Inhibiting expression of this gene delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]

Uniprot Description

TNRC6A: Plays a role in RNA-mediated gene silencing by both micro-RNAs (miRNAs) and short interfering RNAs (siRNAs). Required for miRNA-dependent repression of translation and for siRNA- dependent endonucleolytic cleavage of complementary mRNAs by argonaute family proteins. Belongs to the GW182 family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation; RNA-binding

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: cytosol; Golgi apparatus; intracellular membrane-bound organelle; nucleoplasm

Molecular Function: protein binding

Biological Process: miRNA-mediated gene silencing; miRNA-mediated gene silencing, negative regulation of translation; phosphoinositide-mediated signaling; RNA-mediated gene silencing; RNA-mediated posttranscriptional gene silencing; Wnt receptor signaling pathway, calcium modulating pathway

Research Articles on TNRC6A

Similar Products

Product Notes

The TNRC6A tnrc6a (Catalog #AAA1266689) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcacg gcccgctgat cacattccac ctgaacctcc ctcacggaaa tgctctggtc cgctacagtt caaaagaaga ggtagtgaag gcacaaaagt ctctgcacat gtgtgtactg gggaacacta ctattcttgc tgagtttgcc agtgaagagg agatcagtcg tttctttgca caaagccagt ctctgacccc ttctcccggc tggcagtctc tcgggtccag ccagagccgg ctgggctccc tcgactgttc ccactcattc tccagccgga ccgatctcaa tcactggaat ggtgctgggc tgtcgggaac taactgtgga gaccttcacg gcacttcact ctgggggacc ccgcattatt ccacaagcct gtggggtccc ccaagcagca gcgacccccg aggaattagc agcccatctc ccattaacgc ttttctttct gttgaccacc tgggtggggg tggagagtcc atgtaa. It is sometimes possible for the material contained within the vial of "TNRC6A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.