Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TNFRSF11B cdna clone

TNFRSF11B cDNA Clone

Gene Names
TNFRSF11B; OPG; TR1; OCIF; PDB5
Synonyms
TNFRSF11B; TNFRSF11B cDNA Clone; TNFRSF11B cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaacttgctgtgctgcgcgctcgtgtttctggacatctccattaagtggaccacccaggaaacgtttcctccaaagtaccttcattatgacgaagaaacctctcatcagctgttgtgtgacaaatgtcctcctggtacctacctaaaacaacactgtacagcaaagtggaagaccgtgtgcgccccttgccctgaccactactacacagacagctggcacaccagtgacgagtgtctatactgcagccccgtgtgcaaggagctgcagtacgtcaagcaggagtgcaatcgcacccacaaccgcgtgtgcgaatgcaaggaagggcgctaccttgagatagagttctgcttgaaacataggagctgccctcctggatttggagtggtgcaagctggaaccccagagcgaaatacagtttgcaaaagatgtccagatgggttcttctcaaatgagacgtcatctaaagcaccctgtagaaaacacacaaattgcagtgtctttggtctcctgctaactcagaaaggaaatgcaacacacgacaacatatgttccggaaacagtgaatcaactcaaaaatgtggaatagatgttaccctgtgtgaggaggcattcttcaggtttgctgttcctacaaagtttacgcctaactggcttagtgtcttggtagacaatttgcctggcaccaaagtaaacgcagagagtgtagagaggataaaacggcaacacagctcacaagaacagactttccagctgctgaagttatggaaacatcaaaacaaagaccaagatatagtcaagaagatcatccaagatattgacctctgtgaaaacagcgtgcagcggcacattggacatgctaacctcaccttcgagcagcttcgtagcttgatggaaagcttaccgggaaagaaagtgggagcagaagacattgaaaaaacaataaaggcatgcaaacccagtgaccagatcctgaagctgctcagtttgtggcgaataaaaaatggcgaccaagacaccttgaagggcctaatgcacgcactaaagcactcaaagacgtaccactttcccaaaactgtcactcagagtctaaagaagaccatcaggttccttcacagcttcacaatgtacaaattgtatcagaagttatttttagaaatgataggtaaccaggtccaatcagtaaaaataagctgcttataa
Sequence Length
1206
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,026 Da
NCBI Official Full Name
Homo sapiens tumor necrosis factor receptor superfamily, member 11b, mRNA
NCBI Official Synonym Full Names
TNF receptor superfamily member 11b
NCBI Official Symbol
TNFRSF11B
NCBI Official Synonym Symbols
OPG; TR1; OCIF; PDB5
NCBI Protein Information
tumor necrosis factor receptor superfamily member 11B
UniProt Protein Name
Tumor necrosis factor receptor superfamily member 11B
UniProt Gene Name
TNFRSF11B
UniProt Synonym Gene Names
OCIF; OPG
UniProt Entry Name
TR11B_HUMAN

NCBI Description

The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

TNFRSF11B: Acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. Inhibits the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. May also play a role in preventing arterial calcification. May act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis. Defects in TNFRSF11B are the cause of juvenile Paget disease (JPD); also known as hyperostosis corticalis deformans juvenilis or hereditary hyperphosphatasia or chronic congenital idiopathic hyperphosphatasia. JPD is a rare autosomal recessive osteopathy that presents in infancy or early childhood. The disorder is characterized by rapidly remodeling woven bone, osteopenia, debilitating fractures, and deformities due to a markedly accelerated rate of bone remodeling throughout the skeleton. Approximately 40 cases of JPD have been reported worldwide. Unless it is treated with drugs that block osteoclast- mediated skeletal resorption, the disease can be fatal.

Protein type: Secreted, signal peptide; Inhibitor; Secreted

Chromosomal Location of Human Ortholog: 8q24

Cellular Component: extracellular region; extracellular space; integral to plasma membrane; plasma membrane

Molecular Function: cytokine activity; receptor activity; tumor necrosis factor receptor activity

Biological Process: immune response; inflammatory response; positive regulation of MAPKKK cascade; regulation of apoptosis; regulation of cell proliferation; response to lipopolysaccharide; signal transduction; skeletal development; tumor necrosis factor-mediated signaling pathway

Disease: Paget Disease, Juvenile

Research Articles on TNFRSF11B

Similar Products

Product Notes

The TNFRSF11B tnfrsf11b (Catalog #AAA1278584) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaact tgctgtgctg cgcgctcgtg tttctggaca tctccattaa gtggaccacc caggaaacgt ttcctccaaa gtaccttcat tatgacgaag aaacctctca tcagctgttg tgtgacaaat gtcctcctgg tacctaccta aaacaacact gtacagcaaa gtggaagacc gtgtgcgccc cttgccctga ccactactac acagacagct ggcacaccag tgacgagtgt ctatactgca gccccgtgtg caaggagctg cagtacgtca agcaggagtg caatcgcacc cacaaccgcg tgtgcgaatg caaggaaggg cgctaccttg agatagagtt ctgcttgaaa cataggagct gccctcctgg atttggagtg gtgcaagctg gaaccccaga gcgaaataca gtttgcaaaa gatgtccaga tgggttcttc tcaaatgaga cgtcatctaa agcaccctgt agaaaacaca caaattgcag tgtctttggt ctcctgctaa ctcagaaagg aaatgcaaca cacgacaaca tatgttccgg aaacagtgaa tcaactcaaa aatgtggaat agatgttacc ctgtgtgagg aggcattctt caggtttgct gttcctacaa agtttacgcc taactggctt agtgtcttgg tagacaattt gcctggcacc aaagtaaacg cagagagtgt agagaggata aaacggcaac acagctcaca agaacagact ttccagctgc tgaagttatg gaaacatcaa aacaaagacc aagatatagt caagaagatc atccaagata ttgacctctg tgaaaacagc gtgcagcggc acattggaca tgctaacctc accttcgagc agcttcgtag cttgatggaa agcttaccgg gaaagaaagt gggagcagaa gacattgaaa aaacaataaa ggcatgcaaa cccagtgacc agatcctgaa gctgctcagt ttgtggcgaa taaaaaatgg cgaccaagac accttgaagg gcctaatgca cgcactaaag cactcaaaga cgtaccactt tcccaaaact gtcactcaga gtctaaagaa gaccatcagg ttccttcaca gcttcacaat gtacaaattg tatcagaagt tatttttaga aatgataggt aaccaggtcc aatcagtaaa aataagctgc ttataa. It is sometimes possible for the material contained within the vial of "TNFRSF11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.