Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TNFRSF10A cdna clone

TNFRSF10A cDNA Clone

Gene Names
TNFRSF10A; DR4; APO2; CD261; TRAILR1; TRAILR-1
Synonyms
TNFRSF10A; TNFRSF10A cDNA Clone; TNFRSF10A cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccaccaccagctagagtacatctaggtgcgttcctggcagtgactccgaatcccgggagcgcagcgagtgggacagaggcagccgcggccacacccagcaaagtgtggggctcttccgcggggaggattgaaccacgaggcgggggccgaggagcgctccctacctccatgggacagcacggacccagtgcccgggcccgggcagggcgcgccccaggacccaggccggcgcgggaagccagccctcggctccgggtccacaagaccttcaagtttgtcgtcgtcggggtcctgctgcaggtcgtacctagctcagctgcaaccatcaaacttcatgatcaatcaattggcacacagcaatgggaacatagccctttgggagagttgtgtccaccaggatctcatagatcagaacatcctggagcctgtaaccggtgcacagagggtgtgggttacaccaatgcttccaacaatttgtttgcttgcctcccatgtacagcttgtaaatcagatgaagaagagagaagtccctgcaccacgaccaggaacacagcatgtcagtgcaaaccaggaactttccggaatgacaattctgctgagatgtgccggaagtgcagcagagggtgccccagagggatggtcaaggtcaaggattgtacgccctggagtgacatcgagtgtgtccacaaagaatcaggcaatggacataatatatgggtgattttggttgtgactttggttgttccgttgctgttggtggctgtgctgattgtctgttgttgcatcggctcaggttgtggaggggaccccaagtgcatggacagggtgtgtttctggcgcttgggtctcctacgagggcctggggctgaggacaatgctcacaacgagattctgagcaacgcagactcgctgtccactttcgtctctgagcagcaaatggaaagccaggagccggcagatttgacaggtgtcactgtacagtccccaggggaggcacagtgtctgctgggaccggcagaagctgaagggtctcagaggaggaggctgctggttccagcaaatggtgctgaccccactgagactctgatgctgttctttgacaagtttgcaaacatcgtgccctttgactcctgggaccagctcatgaggcagctggacctcacgaaaaatgagatcgatgtggtcagagctggtacagcaggcccaggggatgccttgtatgcaatgctgatgaaatgggtcaacaaaactggacggaacgcctcgatccacaccctgctggatgccttggagaggatggaagagagacatgcaaaagagaagattcaggacctcttggtggactctggaaagttcatctacttagaagatggcacaggctctgccgtgtccttggagtga
Sequence Length
1407
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,089 Da
NCBI Official Full Name
Homo sapiens tumor necrosis factor receptor superfamily, member 10a, mRNA
NCBI Official Synonym Full Names
TNF receptor superfamily member 10a
NCBI Official Symbol
TNFRSF10A
NCBI Official Synonym Symbols
DR4; APO2; CD261; TRAILR1; TRAILR-1
NCBI Protein Information
tumor necrosis factor receptor superfamily member 10A
UniProt Protein Name
Tumor necrosis factor receptor superfamily member 10A
UniProt Gene Name
TNFRSF10A
UniProt Synonym Gene Names
APO2; DR4; TRAILR1; TRAIL receptor 1; TRAIL-R1
UniProt Entry Name
TR10A_HUMAN

NCBI Description

The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008]

Uniprot Description

TRAIL-R1: Receptor for the cytotoxic ligand TNFSF10/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. Promotes the activation of NF- kappa-B.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 8p21

Cellular Component: cell surface; integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: death receptor activity; protease binding; protein binding; transcription factor binding; tumor necrosis factor receptor activity

Biological Process: caspase activation; cell surface receptor linked signal transduction; immune response; inflammatory response; multicellular organismal development; regulation of apoptosis; regulation of cell proliferation; response to lipopolysaccharide; signal transduction

Research Articles on TNFRSF10A

Similar Products

Product Notes

The TNFRSF10A tnfrsf10a (Catalog #AAA1275766) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccac caccagctag agtacatcta ggtgcgttcc tggcagtgac tccgaatccc gggagcgcag cgagtgggac agaggcagcc gcggccacac ccagcaaagt gtggggctct tccgcgggga ggattgaacc acgaggcggg ggccgaggag cgctccctac ctccatggga cagcacggac ccagtgcccg ggcccgggca gggcgcgccc caggacccag gccggcgcgg gaagccagcc ctcggctccg ggtccacaag accttcaagt ttgtcgtcgt cggggtcctg ctgcaggtcg tacctagctc agctgcaacc atcaaacttc atgatcaatc aattggcaca cagcaatggg aacatagccc tttgggagag ttgtgtccac caggatctca tagatcagaa catcctggag cctgtaaccg gtgcacagag ggtgtgggtt acaccaatgc ttccaacaat ttgtttgctt gcctcccatg tacagcttgt aaatcagatg aagaagagag aagtccctgc accacgacca ggaacacagc atgtcagtgc aaaccaggaa ctttccggaa tgacaattct gctgagatgt gccggaagtg cagcagaggg tgccccagag ggatggtcaa ggtcaaggat tgtacgccct ggagtgacat cgagtgtgtc cacaaagaat caggcaatgg acataatata tgggtgattt tggttgtgac tttggttgtt ccgttgctgt tggtggctgt gctgattgtc tgttgttgca tcggctcagg ttgtggaggg gaccccaagt gcatggacag ggtgtgtttc tggcgcttgg gtctcctacg agggcctggg gctgaggaca atgctcacaa cgagattctg agcaacgcag actcgctgtc cactttcgtc tctgagcagc aaatggaaag ccaggagccg gcagatttga caggtgtcac tgtacagtcc ccaggggagg cacagtgtct gctgggaccg gcagaagctg aagggtctca gaggaggagg ctgctggttc cagcaaatgg tgctgacccc actgagactc tgatgctgtt ctttgacaag tttgcaaaca tcgtgccctt tgactcctgg gaccagctca tgaggcagct ggacctcacg aaaaatgaga tcgatgtggt cagagctggt acagcaggcc caggggatgc cttgtatgca atgctgatga aatgggtcaa caaaactgga cggaacgcct cgatccacac cctgctggat gccttggaga ggatggaaga gagacatgca aaagagaaga ttcaggacct cttggtggac tctggaaagt tcatctactt agaagatggc acaggctctg ccgtgtcctt ggagtga. It is sometimes possible for the material contained within the vial of "TNFRSF10A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.