TMTC1 cdna clone
TMTC1 cDNA Clone
Gene Names
TMTC1; OLF; ARG99; TMTC1A
Synonyms
TMTC1; TMTC1 cDNA Clone; TMTC1 cdna clone
Sequence
atggtgaacttgggaagactctacaggtcactgggagagaacagcatggctgaagaatgcgccctgcaggtggcacacaaagctgagatattgtcacctttgggagcactgtattacaacactggccgatacgaagaggctttgcagatttaccaggaagctgcagcacttcagccttctcagagggagctccgcttggcactggctcaggttttggccgtgatgggtcagacaaaagaagctgaaaagatgaccaatcacattgtgtcagaggagaccggatgccttgaatgctatcgcctcttgtcagccatctatagcaagcaggagaaccacgacaaggcacttgatgctatagacaaggctctccagctgaaaccaaaggacccaaaagtcatttctgaactttttttcacaaaaggaaaccaattaagagagcagaaccttctcgacaaagcttttgagagctatagagtggctgtgcaactaaacccagaccaagcacaggcctggatgaacatgggtggcatccaacacatcaagggaaaatatgtgtctgcaagagcttattatgagagagccttacagctggttccagacagcaaactgctgaaggaaaatcttgccaaattggatcgcctagaaaaacgattacaagaagttcgagaaaaggatcaaacatag
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,859 Da
NCBI Official Full Name
Homo sapiens transmembrane and tetratricopeptide repeat containing 1, mRNA
NCBI Official Synonym Full Names
transmembrane and tetratricopeptide repeat containing 1
NCBI Official Symbol
TMTC1
NCBI Official Synonym Symbols
OLF; ARG99; TMTC1A
NCBI Protein Information
transmembrane and TPR repeat-containing protein 1
UniProt Protein Name
Transmembrane and TPR repeat-containing protein 1
Protein Family
UniProt Gene Name
TMTC1
UniProt Entry Name
TMTC1_HUMAN
Uniprot Description
TMTC1: Belongs to the TMTC family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12p11.22
Research Articles on TMTC1
Similar Products
Product Notes
The TMTC1 tmtc1 (Catalog #AAA1269682) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaact tgggaagact ctacaggtca ctgggagaga acagcatggc tgaagaatgc gccctgcagg tggcacacaa agctgagata ttgtcacctt tgggagcact gtattacaac actggccgat acgaagaggc tttgcagatt taccaggaag ctgcagcact tcagccttct cagagggagc tccgcttggc actggctcag gttttggccg tgatgggtca gacaaaagaa gctgaaaaga tgaccaatca cattgtgtca gaggagaccg gatgccttga atgctatcgc ctcttgtcag ccatctatag caagcaggag aaccacgaca aggcacttga tgctatagac aaggctctcc agctgaaacc aaaggaccca aaagtcattt ctgaactttt tttcacaaaa ggaaaccaat taagagagca gaaccttctc gacaaagctt ttgagagcta tagagtggct gtgcaactaa acccagacca agcacaggcc tggatgaaca tgggtggcat ccaacacatc aagggaaaat atgtgtctgc aagagcttat tatgagagag ccttacagct ggttccagac agcaaactgc tgaaggaaaa tcttgccaaa ttggatcgcc tagaaaaacg attacaagaa gttcgagaaa aggatcaaac atag. It is sometimes possible for the material contained within the vial of "TMTC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
