TMPRSS11B cdna clone
TMPRSS11B cDNA Clone
Synonyms
TMPRSS11B; TMPRSS11B cDNA Clone; TMPRSS11B cdna clone
Sequence
atgtacaggcacggcatatcttcccaaagatcttggccactatggactacgatctttatttttcttggagtggcggcaatcttgggagtaaccattggtcttcttgttcattttctggcagttgagaagacttactattatcaaggtgattttcatatttctggagtcacatacaatgataattgtgaaaacgcagcttcacaagccagcacaaatctaagcaaagatattgagactaagatgttaaatgcatttcaaaattccagtatatataaggaatatgtcaaatctgaggtcatcaaacttctgcctaatgccaatggttcaaatgtgcagttacagctgaaattcaagtttcctccagcagaaggagttagcatgaggactaaaatcaaggctaaattacatcagatgttgaaaaacaacatggcatcctggaatgcagttcctgcttccattaaactcatggaaatcagcaaggctgcttctgaaatgcttaccaacaactgttgtgggagacaagtagccaacagtatcataactggcaacaaaattgtgaatggaaaaagctccctggagggggcatggccatggcaggccagcatgcaatggaaaggccgtcactactgtggagcctctctgatcagcagcaggtggctattatctgcagctcactgctttgctaagaaaaataattcaaaagattggactgtcaactttggagttgtagtaaataaaccatatatgacacggaaagtccaaaacattatttttcatgaaaattatagcagtcctgggcttcatgatgatattgcccttgtgcagcttgctgaagaagtttcttttacagagtacattcgtaagatttgtcttcctgaagccaaaatgaagctctcagaaaatgacaatgttgtagttacaggttggggaacactttatatgaatggttcatttccagtgatacttcaagaagcctttttgaagattattgacaacaaaatttgcaatgcctcatatgcatactctggctttgtgactgattcaatgttatgtgctggatttatgtcaggagaagctgatgcatgtcagaatgattctggtggaccactagcttaccctgattccagaaatatctggcatcttgttggaatagtaagctggggtgatggatgtggtaaaaagaataagccaggtgtctatactcgagtgacttcttatcgcaattggattacatccaagactggactctga
Sequence Length
1251
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,337 Da
NCBI Official Full Name
Homo sapiens transmembrane protease, serine 11B, mRNA
NCBI Official Synonym Full Names
transmembrane protease, serine 11B
NCBI Official Symbol
TMPRSS11B
NCBI Protein Information
transmembrane protease serine 11B
UniProt Protein Name
Transmembrane protease serine 11B
Protein Family
UniProt Gene Name
TMPRSS11B
UniProt Synonym Gene Names
HATL5
UniProt Entry Name
TM11B_HUMAN
Uniprot Description
TMPRSS11B: Probable serine protease. Belongs to the peptidase S1 family.
Protein type: Membrane protein, integral; Protease; EC 3.4.21.-
Chromosomal Location of Human Ortholog: 4q13.2
Cellular Component: plasma membrane
Molecular Function: serine-type peptidase activity
Research Articles on TMPRSS11B
Similar Products
Product Notes
The TMPRSS11B tmprss11b (Catalog #AAA1278964) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaggc acggcatatc ttcccaaaga tcttggccac tatggactac gatctttatt tttcttggag tggcggcaat cttgggagta accattggtc ttcttgttca ttttctggca gttgagaaga cttactatta tcaaggtgat tttcatattt ctggagtcac atacaatgat aattgtgaaa acgcagcttc acaagccagc acaaatctaa gcaaagatat tgagactaag atgttaaatg catttcaaaa ttccagtata tataaggaat atgtcaaatc tgaggtcatc aaacttctgc ctaatgccaa tggttcaaat gtgcagttac agctgaaatt caagtttcct ccagcagaag gagttagcat gaggactaaa atcaaggcta aattacatca gatgttgaaa aacaacatgg catcctggaa tgcagttcct gcttccatta aactcatgga aatcagcaag gctgcttctg aaatgcttac caacaactgt tgtgggagac aagtagccaa cagtatcata actggcaaca aaattgtgaa tggaaaaagc tccctggagg gggcatggcc atggcaggcc agcatgcaat ggaaaggccg tcactactgt ggagcctctc tgatcagcag caggtggcta ttatctgcag ctcactgctt tgctaagaaa aataattcaa aagattggac tgtcaacttt ggagttgtag taaataaacc atatatgaca cggaaagtcc aaaacattat ttttcatgaa aattatagca gtcctgggct tcatgatgat attgcccttg tgcagcttgc tgaagaagtt tcttttacag agtacattcg taagatttgt cttcctgaag ccaaaatgaa gctctcagaa aatgacaatg ttgtagttac aggttgggga acactttata tgaatggttc atttccagtg atacttcaag aagccttttt gaagattatt gacaacaaaa tttgcaatgc ctcatatgca tactctggct ttgtgactga ttcaatgtta tgtgctggat ttatgtcagg agaagctgat gcatgtcaga atgattctgg tggaccacta gcttaccctg attccagaaa tatctggcat cttgttggaa tagtaagctg gggtgatgga tgtggtaaaa agaataagcc aggtgtctat actcgagtga cttcttatcg caattggatt acatccaaga ctggactctg a. It is sometimes possible for the material contained within the vial of "TMPRSS11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
