TMEM66 cdna clone

TMEM66 cDNA Clone

Gene Names

SARAF; XTP3; FOAP-7; TMEM66; HSPC035

Synonyms

TMEM66; TMEM66 cDNA Clone; TMEM66 cdna clone

Ordering
Cat. Num. AAA1278855 For Research Use Only!

Sequence

atggccgcagcctgcgggccgggagcggccgggtactgcttgctcctcggcttgcatttgtttctgctgaccgcgggccctgccctgggctggaacgaccctgacagaatgttgctgcgggatgtaaaagctcttaccctccactatgaccgctataccacctcccgcaggctggatcccatcccacagttgaaatgtgttggaggcacagctggttgtgattcttataccccaaaagtcatacagtgtcagaacaaaggctgggatgggtatgatgtacagtgggaatgtaagacggacttagatattgcatacaaatttggaaaaactgtggtgagctgtgaaggctatgagtcctctgaagaccagtatgtactaagaggttcttgtggcttggagtataatttagattatacagaacttggcctgcagaaactgaaggagtctggaaagcagcacggctttgcctctttctctgattattattataagtggtcctcggcggattcctgtaacatgagtggattgattaccatcgtggtactccttgggatcgcctttgtagtctataagctgttcctgagtgacgggcagtattctcctccaccgtactctgagtatcctccattttcccaccgttaccagagattcaccaactcagcaggacctcctcccccaggctttaagtctgagttcacaggaccacagaatactggccatggtgcaacttctggttttggcagtgcttttacaggacaacaaggatatgaaaattcaggaccagggttctggacaggcttgggaactggtggaatactaggatatttgtttggcagcaatagagcggcaacacccttctcagactcgtggtactacccgtcctatcctccctcctaccctggcacgtggaatagggcttactcaccccttcatggaggctcgggcagctattcggtatgttcaaactcagacacgaaaaccagaactgcatcaggatatggtggtaccaggagacgataa

Sequence Length

1020

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

15929106

NCBI GeneID

51669

Molecular Weight

17,876 Da

NCBI Official Full Name

Homo sapiens transmembrane protein 66, mRNA

NCBI Official Synonym Full Names

store-operated calcium entry associated regulatory factor

NCBI Official Symbol

SARAF

NCBI Official Synonym Symbols

XTP3; FOAP-7; TMEM66; HSPC035

NCBI Protein Information

store-operated calcium entry-associated regulatory factor

UniProt Protein Name

Store-operated calcium entry-associated regulatory factor

UniProt Gene Name

SARAF

UniProt Synonym Gene Names

TMEM66; XTP3; SARAF; SOCE-associated regulatory factor

UniProt Entry Name

SARAF_HUMAN

Uniprot Description

TMEM66: Negative regulator of store-operated Ca(2+) entry (SOCE) involved in protecting cells from Ca(2+) overfilling. In response to cytosolic Ca(2+) elevation after endoplasmic reticulum Ca(2+) refilling, promotes a slow inactivation of STIM (STIM1 or STIM2)- dependent SOCE activity: possibly act by facilitating the deoligomerization of STIM to efficiently turn off ORAI when the endoplasmic reticulum lumen is filled with the appropriate Ca(2+) levels, and thus preventing the overload of the cell with excessive Ca(2+) ions. Belongs to the SARAF family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 8p12

Cellular Component: integral to endoplasmic reticulum membrane

Molecular Function: protein binding

Research Articles on TMEM66

1. SARAF is constitutively expressed in the plasma membrane and interacts with Orai1.

Similar Products

Product Notes

The TMEM66 saraf (Catalog #AAA1278855) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcag cctgcgggcc gggagcggcc gggtactgct tgctcctcgg cttgcatttg tttctgctga ccgcgggccc tgccctgggc tggaacgacc ctgacagaat gttgctgcgg gatgtaaaag ctcttaccct ccactatgac cgctatacca cctcccgcag gctggatccc atcccacagt tgaaatgtgt tggaggcaca gctggttgtg attcttatac cccaaaagtc atacagtgtc agaacaaagg ctgggatggg tatgatgtac agtgggaatg taagacggac ttagatattg catacaaatt tggaaaaact gtggtgagct gtgaaggcta tgagtcctct gaagaccagt atgtactaag aggttcttgt ggcttggagt ataatttaga ttatacagaa cttggcctgc agaaactgaa ggagtctgga aagcagcacg gctttgcctc tttctctgat tattattata agtggtcctc ggcggattcc tgtaacatga gtggattgat taccatcgtg gtactccttg ggatcgcctt tgtagtctat aagctgttcc tgagtgacgg gcagtattct cctccaccgt actctgagta tcctccattt tcccaccgtt accagagatt caccaactca gcaggacctc ctcccccagg ctttaagtct gagttcacag gaccacagaa tactggccat ggtgcaactt ctggttttgg cagtgctttt acaggacaac aaggatatga aaattcagga ccagggttct ggacaggctt gggaactggt ggaatactag gatatttgtt tggcagcaat agagcggcaa cacccttctc agactcgtgg tactacccgt cctatcctcc ctcctaccct ggcacgtgga atagggctta ctcacccctt catggaggct cgggcagcta ttcggtatgt tcaaactcag acacgaaaac cagaactgca tcaggatatg gtggtaccag gagacgataa. It is sometimes possible for the material contained within the vial of "TMEM66, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

TMEM66 cdna clone