TMEM185B cdna clone
TMEM185B cDNA Clone
Gene Names
TMEM185B; FAM11B
Synonyms
TMEM185B; TMEM185B cDNA Clone; TMEM185B cdna clone
Sequence
atgaaccccaggggcctgttccaggacttcaaccccagtaagtttctcatctacacctgcctgctgctcttctcggtgctgctgcccctccgcctggacggcatcatccagtggagctactgggccgtctttgcccccatatggctgtggaagcttctagtcgtcgcaggcgcctccgtgggcgcgggcgtttgggcccgcaaccctcgctaccgcaccgagggagaggcctgtgtggagttcaaagccatgctgatcgctgtgggcatccacctgctgctgctcatgttcgaagtcctggtctgcgacagggtggagaggggcacccacttctggctgctggtcttcatgcctctcttcttcgtgtcccccgtgtccgtggctgcctgcgtctggggctttcgacacgataggtcgctggagctggagatcctgtgctcggtcaacatcctgcagttcatcttcatcgccctaaagctggacaggattattcactggccgtggctggtggtgtttgtgcccctgtggatcctcatgtcgttcctttgcctggtcgtcctctattacatcgtctggtccctcctgttcctgcggtccctggatgtggttgccgagcagcggagaacacacgtgaccatggctatcagttggataacgattgtcgtgcctctgctcacttttgaggtcctgctggttcacagattggatggccacaatacattctcctacgtctccatatttgtccccctttggctttccttactaactttaatggccacaacatttaggcgaaaggggggcaatcattggtggtttggcattcgcagagacttctgtcagtttctgcttgaaattttcccatttttaagagaatatgggaacatttcatatgatctccatcacgaagatagtgaagatgctgaagaaacatcagttccagaagctccgaaaattgctccaatatttggaaagaaggccagagtagttataacccagagccctgggaaatacgttcccccccctcccaagttaaatattgatatgccagattaa
Sequence Length
1053
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,599 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 185B (pseudogene), mRNA
NCBI Official Synonym Full Names
transmembrane protein 185B
NCBI Official Symbol
TMEM185B
NCBI Official Synonym Symbols
FAM11B
NCBI Protein Information
transmembrane protein 185B
UniProt Protein Name
Transmembrane protein 185B
Protein Family
UniProt Gene Name
TMEM185B
UniProt Synonym Gene Names
FAM11B
UniProt Entry Name
T185B_HUMAN
Uniprot Description
TMEM185B: Belongs to the TMEM185 family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2q14.2
Research Articles on TMEM185B
Similar Products
Product Notes
The TMEM185B tmem185b (Catalog #AAA1272565) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca ggggcctgtt ccaggacttc aaccccagta agtttctcat ctacacctgc ctgctgctct tctcggtgct gctgcccctc cgcctggacg gcatcatcca gtggagctac tgggccgtct ttgcccccat atggctgtgg aagcttctag tcgtcgcagg cgcctccgtg ggcgcgggcg tttgggcccg caaccctcgc taccgcaccg agggagaggc ctgtgtggag ttcaaagcca tgctgatcgc tgtgggcatc cacctgctgc tgctcatgtt cgaagtcctg gtctgcgaca gggtggagag gggcacccac ttctggctgc tggtcttcat gcctctcttc ttcgtgtccc ccgtgtccgt ggctgcctgc gtctggggct ttcgacacga taggtcgctg gagctggaga tcctgtgctc ggtcaacatc ctgcagttca tcttcatcgc cctaaagctg gacaggatta ttcactggcc gtggctggtg gtgtttgtgc ccctgtggat cctcatgtcg ttcctttgcc tggtcgtcct ctattacatc gtctggtccc tcctgttcct gcggtccctg gatgtggttg ccgagcagcg gagaacacac gtgaccatgg ctatcagttg gataacgatt gtcgtgcctc tgctcacttt tgaggtcctg ctggttcaca gattggatgg ccacaataca ttctcctacg tctccatatt tgtccccctt tggctttcct tactaacttt aatggccaca acatttaggc gaaagggggg caatcattgg tggtttggca ttcgcagaga cttctgtcag tttctgcttg aaattttccc atttttaaga gaatatggga acatttcata tgatctccat cacgaagata gtgaagatgc tgaagaaaca tcagttccag aagctccgaa aattgctcca atatttggaa agaaggccag agtagttata acccagagcc ctgggaaata cgttcccccc cctcccaagt taaatattga tatgccagat taa. It is sometimes possible for the material contained within the vial of "TMEM185B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
