TMEM184B cdna clone

TMEM184B cDNA Clone

Gene Names

TMEM184B; FM08; HS5O6A; C22orf5; HSPC256

Synonyms

TMEM184B; TMEM184B cDNA Clone; TMEM184B cdna clone

Ordering
Cat. Num. AAA1268353 For Research Use Only!

Sequence

atgacagtgaggggggatgtgctggccccggatccagcgtcgcccacgaccgcagcagcctcgcccagcgtctccgtgatccccgagggcagccccactgccatggagcagcctgtgttcctgatgacaactgccgctcaggccatctctggcttcttcgtgtggacggccctgctcatcacatgccaccagatctacatgcacctgcgctgctacagctgccccaacgagcagcgctacatcgtgcgcatcctcttcatcgtgcccatctacgcctttgactcctggctcagcctcctcttcttcaccaacgaccagtactacgtgtacttcggcaccgtccgcgactgctatgaggccttggtcatctataatttcctgagcctgtgctatgagtacctaggaggagaaagttccatcatgtcggagatcagaggaaaacccattgagtccagctgtatgtatggcacctgctgcctctggggaaagacttattccatcggatttctgaggttctgcaaacaggccaccctgcagttctgtgtggtgaagccactcatggcggtcagcactgtggtcctccaggccttcggcaagtaccgggatggggactttgacgtcaccagtggctacctctacgtgaccatcatctacaacatctccgtcagcctggccctctacgccctcttcctcttctacttcgccacccgggagctgctcagcccctacagccccgtcctcaagttcttcatggtcaagtccgtcatctttctttccttctggcaaggcatgctcctggccatcctggagaagtgtggggccatccccaaaatccactcggcccgcgtgtcggtgggcgagggcaccgtggctgccggctaccaggacttcatcatctgtgtggagatgttctttgcagccctggccctgcggcacgccttcacctacaaggtctatgctgacaagaggctggacgcacaaggccgctgtgcccccatgaagagcatctccagcagcctcaaggagaccatgaacccgcacgacatcgtgcaggacgccatccacaacttctcacctgcctaccagcagtacacgcagcagtccaccctggagcctgggcccacctggcgtggtggcgcccacggcctctcccgctcccacagcctcagtggcgcccgcgacaacgagaagactctcctgctcagctctgatgatgaattctag

Sequence Length

1224

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

15930089

NCBI GeneID

25829

Molecular Weight

45,562 Da

NCBI Official Full Name

Homo sapiens transmembrane protein 184B, mRNA

NCBI Official Synonym Full Names

transmembrane protein 184B

NCBI Official Symbol

TMEM184B

NCBI Official Synonym Symbols

FM08; HS5O6A; C22orf5; HSPC256

NCBI Protein Information

transmembrane protein 184B

UniProt Protein Name

Transmembrane protein 184B

Protein Family

Transmembrane protein

UniProt Gene Name

TMEM184B

UniProt Synonym Gene Names

C22orf5

UniProt Entry Name

T184B_HUMAN

Uniprot Description

TMEM184B: May activate the MAP kinase signaling pathway. Belongs to the TMEM184 family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 22q12

Cellular Component: integral to membrane

Molecular Function: transporter activity

Biological Process: transport

Research Articles on TMEM184B

1. Data shows that miR-26a and miR-26b were significantly downregulated and their direct target, TMEM184B significantly up-regulated in oral squamous cell carcinoma cells.

Similar Products

Product Notes

The TMEM184B tmem184b (Catalog #AAA1268353) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacagtga ggggggatgt gctggccccg gatccagcgt cgcccacgac cgcagcagcc tcgcccagcg tctccgtgat ccccgagggc agccccactg ccatggagca gcctgtgttc ctgatgacaa ctgccgctca ggccatctct ggcttcttcg tgtggacggc cctgctcatc acatgccacc agatctacat gcacctgcgc tgctacagct gccccaacga gcagcgctac atcgtgcgca tcctcttcat cgtgcccatc tacgcctttg actcctggct cagcctcctc ttcttcacca acgaccagta ctacgtgtac ttcggcaccg tccgcgactg ctatgaggcc ttggtcatct ataatttcct gagcctgtgc tatgagtacc taggaggaga aagttccatc atgtcggaga tcagaggaaa acccattgag tccagctgta tgtatggcac ctgctgcctc tggggaaaga cttattccat cggatttctg aggttctgca aacaggccac cctgcagttc tgtgtggtga agccactcat ggcggtcagc actgtggtcc tccaggcctt cggcaagtac cgggatgggg actttgacgt caccagtggc tacctctacg tgaccatcat ctacaacatc tccgtcagcc tggccctcta cgccctcttc ctcttctact tcgccacccg ggagctgctc agcccctaca gccccgtcct caagttcttc atggtcaagt ccgtcatctt tctttccttc tggcaaggca tgctcctggc catcctggag aagtgtgggg ccatccccaa aatccactcg gcccgcgtgt cggtgggcga gggcaccgtg gctgccggct accaggactt catcatctgt gtggagatgt tctttgcagc cctggccctg cggcacgcct tcacctacaa ggtctatgct gacaagaggc tggacgcaca aggccgctgt gcccccatga agagcatctc cagcagcctc aaggagacca tgaacccgca cgacatcgtg caggacgcca tccacaactt ctcacctgcc taccagcagt acacgcagca gtccaccctg gagcctgggc ccacctggcg tggtggcgcc cacggcctct cccgctccca cagcctcagt ggcgcccgcg acaacgagaa gactctcctg ctcagctctg atgatgaatt ctag. It is sometimes possible for the material contained within the vial of "TMEM184B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

TMEM184B cdna clone