TMEM175 cdna clone
TMEM175 cDNA Clone
Gene Names
TMEM175; hTMEM175
Synonyms
TMEM175; TMEM175 cDNA Clone; TMEM175 cdna clone
Sequence
atgtcccagccccggaccccagagcaggcactggatacaccgggggactgccccccaggcaggagagacgaggacgctggggaggggatccagtgctcccaacgcatgctcagcttcagtgacgccctgctgtccatcatcgccaccgtcatgatcctgcctgtgacccacacggagatctccccagaacagcagttcgacagaagtgtacagaggcttctggcaacacggattgccgtctacctgatgacctttctcatcgtgacagtggcctgggcagcacacacaaggttgttccaagttgttgggaaaacagacgacacacttgccctgctcaacctggcctgcatgatgaccatcaccttcctgccttacacgttttcgttaatggtgaccttccctgatgtgcctctgggcatcttcttgttctgtgtgtgtgtgatcgccatcggggtcgtgcaggcactgattgtggggtacgcattccacttcccgcacctgctgagcccgcagatccagcgctctgcccacagggctctgtaccgacgacacgtcctgggcatcgtcctccaaggcccggccctgtgctttgcagcggccatcttctctctcttctttgtccccttgtcttacctgctgatggtgactgtcatcctcctcccctatgtcagcaaggtcaccggctggtgcagagacaggctcctgggccacagggagccctcggctcacccagtggaagtcttctcgtttgacctccacgagccactcagcaaggagcgcgtggaagccttcagcgacggagtctacgccatcgtggccacgcttctcatcctggacatctgcgaagacaacgtcccggaccccaaggatgtgaaggagaggttcagcggcagcctcgtggccgccctgagtgcgaccgggccgcgcttcctggcgtacttcggctccttcgccacagtgggactgctgtggttcgcccaccactcactcttcctgcatgtgcgcaaggccacgcgggccatggggctgctgaacacgctctcgctggccttcgtgggtggcctcccactagcctaccagcagacctcggccttcgcccggcagccccgcgatgagctggagcgcgtgcgtgtcagctgcaccatcatcttcctggccagcatcttccagctggccatgtggaccacggcgctgctgcaccaggcggagacgctgcagccctcggtgtggtttggcggccgggagcatgtgctcatgttcgccaagctggcgctgtacccctgtgccagcctgctggccttcgcctccacctgcctgctgagcaggttcagtgtgggcatcttccacctcatgcagatcgccgtgccctgcgccttcctgttgctgcgcctgctcgtgggcctggccctggccaccctgcgggtcctgcggggcctcgcccggcccgaacaccccccgccagcccccacgggccaggacgacccacagtcccagctcctccctgccccctgctag
Sequence Length
1515
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,847 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 175, mRNA
NCBI Official Synonym Full Names
transmembrane protein 175
NCBI Official Symbol
TMEM175
NCBI Official Synonym Symbols
hTMEM175
NCBI Protein Information
endosomal/lysomomal potassium channel TMEM175
UniProt Protein Name
Endosomal/lysomomal potassium channel TMEM175
Protein Family
UniProt Gene Name
TMEM175
UniProt Synonym Gene Names
hTMEM175
UniProt Entry Name
TM175_HUMAN
Uniprot Description
TMEM175: Belongs to the TMEM175 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 4p16.3
Cellular Component: endosome; lysosomal membrane; lysosome
Molecular Function: potassium ion leak channel activity
Research Articles on TMEM175
Similar Products
Product Notes
The TMEM175 tmem175 (Catalog #AAA1274054) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccagc cccggacccc agagcaggca ctggatacac cgggggactg ccccccaggc aggagagacg aggacgctgg ggaggggatc cagtgctccc aacgcatgct cagcttcagt gacgccctgc tgtccatcat cgccaccgtc atgatcctgc ctgtgaccca cacggagatc tccccagaac agcagttcga cagaagtgta cagaggcttc tggcaacacg gattgccgtc tacctgatga cctttctcat cgtgacagtg gcctgggcag cacacacaag gttgttccaa gttgttggga aaacagacga cacacttgcc ctgctcaacc tggcctgcat gatgaccatc accttcctgc cttacacgtt ttcgttaatg gtgaccttcc ctgatgtgcc tctgggcatc ttcttgttct gtgtgtgtgt gatcgccatc ggggtcgtgc aggcactgat tgtggggtac gcattccact tcccgcacct gctgagcccg cagatccagc gctctgccca cagggctctg taccgacgac acgtcctggg catcgtcctc caaggcccgg ccctgtgctt tgcagcggcc atcttctctc tcttctttgt ccccttgtct tacctgctga tggtgactgt catcctcctc ccctatgtca gcaaggtcac cggctggtgc agagacaggc tcctgggcca cagggagccc tcggctcacc cagtggaagt cttctcgttt gacctccacg agccactcag caaggagcgc gtggaagcct tcagcgacgg agtctacgcc atcgtggcca cgcttctcat cctggacatc tgcgaagaca acgtcccgga ccccaaggat gtgaaggaga ggttcagcgg cagcctcgtg gccgccctga gtgcgaccgg gccgcgcttc ctggcgtact tcggctcctt cgccacagtg ggactgctgt ggttcgccca ccactcactc ttcctgcatg tgcgcaaggc cacgcgggcc atggggctgc tgaacacgct ctcgctggcc ttcgtgggtg gcctcccact agcctaccag cagacctcgg ccttcgcccg gcagccccgc gatgagctgg agcgcgtgcg tgtcagctgc accatcatct tcctggccag catcttccag ctggccatgt ggaccacggc gctgctgcac caggcggaga cgctgcagcc ctcggtgtgg tttggcggcc gggagcatgt gctcatgttc gccaagctgg cgctgtaccc ctgtgccagc ctgctggcct tcgcctccac ctgcctgctg agcaggttca gtgtgggcat cttccacctc atgcagatcg ccgtgccctg cgccttcctg ttgctgcgcc tgctcgtggg cctggccctg gccaccctgc gggtcctgcg gggcctcgcc cggcccgaac accccccgcc agcccccacg ggccaggacg acccacagtc ccagctcctc cctgccccct gctag. It is sometimes possible for the material contained within the vial of "TMEM175, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
