Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMCO7 cdna clone

TMCO7 cDNA Clone

Gene Names
TANGO6; TMCO7
Synonyms
TMCO7; TMCO7 cDNA Clone; TMCO7 cdna clone
Ordering
For Research Use Only!
Sequence
atggattccctgcttccagtcctgggagtgctttttcttctctactgttttactaagcagagtgtgtctcacataaggtcactttgccaagaaatcttattatggattctggggaagctggaaaggaagaaggcaattgccagcctgaaaggatttgcagggttggacaaagctgtgccctctctccattctctgtgtcagtttagagttgccactcaaggtggcattatgattaccatcaaagaggccattagtgatgaagatgaagatgaagccctgtaccagaaggtatcctctgagcagggccgggtggagcatctcggggacttgctgtcccactgccaggaatgcggtttggcaggagacttcttcatcttctgtttgaaagagttgactcatgtggcctcggaaaatgaaacagagttaaaaactgagcccttctccagcaagagcctcttggaattagagcaacatcagactcttcttgtggaaggccaagagcggaagctgcttgtcctgcagctgatggctgttctgtgcgagagaatgtctgagcagatattcacaaacgtcactcaggtggtggactttgtagcagcaacattgcagagagcctgtgcaagcctggcccatcaggcagagagcaccgtggaatcacagacgctgagcatgtccatggggctggtggctgtcatgctaggaggagctgttcagttgaagtcaagtgattttgctgttctgaagcagttgttgcctctgttggagaaggtatccaacacataccctgatccggtcatccaagaactcgctgttgatctccgcatcaccatctctacccatggagcctttgccactgaggccgtcagcatggctgcccaaagtacactgaacagaaaagatctggaagggaaaatagaagagcagcaacaaaccagtcatgaaagacccactgatgtagctcatagccaccttgaacaacagcagagccatgagacagccccccagacaggcctgcagtcaaatgctccaatcattcctcaaggagtcaatgagcccagcactactacaagtcagaaatctggaagcgtaaccacagaacagctccaagaggttcttttgtcagcttatgaccctcaaattccaacacgggctgctgccctgcgtactctttcccactggatagagcagagagaagcaaaagcccttgagatgcaagagaagcttctcaagatattcttggaaaacttggaacatgaagacacttttgtatatctatctgcaattcagggggttgccctgctgtcagacgtctatcctgagaaaatcttgccggacttgttggctcaatatgacagcagcaaagacaagcacacaccagagaccagaatgaaagtcggggaagtccttatgcgaatcgtcagggcattaggagacatggtctcaaagtaccgagaacctttgatccataccttcctgaggggagtgagagatcctgatggtgctcacagggccagcagcttggccaaccttggggagctgtgccagaggctggactttctgctgggctccgtggtccatgaggtaacagcttgcctgattgctgtggccaaaacagatggtgaagttcaagtacgcagagctgccatacatgtggttgtgctgctgcttcggggactcagccagaaagctactgaggtgctgagcgccgtcctcaaggatctctaccacctgctgaagcacgtagtgtgtctggagcccgatgacgtggccaagctccatgcccagttggccctagaagagctggatgacatcatgaaaaacttcctgttccctccacagaagctggagaagaagatcatggtcctgccgtag
Sequence Length
1872
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
120,748 Da
NCBI Official Full Name
Homo sapiens hypothetical protein FLJ12688, mRNA
NCBI Official Synonym Full Names
transport and golgi organization 6 homolog
NCBI Official Symbol
TANGO6
NCBI Official Synonym Symbols
TMCO7
NCBI Protein Information
transport and Golgi organization protein 6 homolog
UniProt Protein Name
Transport and Golgi organization protein 6 homolog
UniProt Gene Name
TANGO6
UniProt Synonym Gene Names
KIAA1746; TMCO7
UniProt Entry Name
TNG6_HUMAN

Uniprot Description

TANGO6: Belongs to the TMCO7 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 16q22.1

Similar Products

Product Notes

The TMCO7 tango6 (Catalog #AAA1266003) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattccc tgcttccagt cctgggagtg ctttttcttc tctactgttt tactaagcag agtgtgtctc acataaggtc actttgccaa gaaatcttat tatggattct ggggaagctg gaaaggaaga aggcaattgc cagcctgaaa ggatttgcag ggttggacaa agctgtgccc tctctccatt ctctgtgtca gtttagagtt gccactcaag gtggcattat gattaccatc aaagaggcca ttagtgatga agatgaagat gaagccctgt accagaaggt atcctctgag cagggccggg tggagcatct cggggacttg ctgtcccact gccaggaatg cggtttggca ggagacttct tcatcttctg tttgaaagag ttgactcatg tggcctcgga aaatgaaaca gagttaaaaa ctgagccctt ctccagcaag agcctcttgg aattagagca acatcagact cttcttgtgg aaggccaaga gcggaagctg cttgtcctgc agctgatggc tgttctgtgc gagagaatgt ctgagcagat attcacaaac gtcactcagg tggtggactt tgtagcagca acattgcaga gagcctgtgc aagcctggcc catcaggcag agagcaccgt ggaatcacag acgctgagca tgtccatggg gctggtggct gtcatgctag gaggagctgt tcagttgaag tcaagtgatt ttgctgttct gaagcagttg ttgcctctgt tggagaaggt atccaacaca taccctgatc cggtcatcca agaactcgct gttgatctcc gcatcaccat ctctacccat ggagcctttg ccactgaggc cgtcagcatg gctgcccaaa gtacactgaa cagaaaagat ctggaaggga aaatagaaga gcagcaacaa accagtcatg aaagacccac tgatgtagct catagccacc ttgaacaaca gcagagccat gagacagccc cccagacagg cctgcagtca aatgctccaa tcattcctca aggagtcaat gagcccagca ctactacaag tcagaaatct ggaagcgtaa ccacagaaca gctccaagag gttcttttgt cagcttatga ccctcaaatt ccaacacggg ctgctgccct gcgtactctt tcccactgga tagagcagag agaagcaaaa gcccttgaga tgcaagagaa gcttctcaag atattcttgg aaaacttgga acatgaagac acttttgtat atctatctgc aattcagggg gttgccctgc tgtcagacgt ctatcctgag aaaatcttgc cggacttgtt ggctcaatat gacagcagca aagacaagca cacaccagag accagaatga aagtcgggga agtccttatg cgaatcgtca gggcattagg agacatggtc tcaaagtacc gagaaccttt gatccatacc ttcctgaggg gagtgagaga tcctgatggt gctcacaggg ccagcagctt ggccaacctt ggggagctgt gccagaggct ggactttctg ctgggctccg tggtccatga ggtaacagct tgcctgattg ctgtggccaa aacagatggt gaagttcaag tacgcagagc tgccatacat gtggttgtgc tgctgcttcg gggactcagc cagaaagcta ctgaggtgct gagcgccgtc ctcaaggatc tctaccacct gctgaagcac gtagtgtgtc tggagcccga tgacgtggcc aagctccatg cccagttggc cctagaagag ctggatgaca tcatgaaaaa cttcctgttc cctccacaga agctggagaa gaagatcatg gtcctgccgt ag. It is sometimes possible for the material contained within the vial of "TMCO7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.