TLCD1 cdna clone
TLCD1 cDNA Clone
Synonyms
TLCD1; TLCD1 cDNA Clone; TLCD1 cdna clone
Sequence
atgccccgactgctgcaccccgccctgccgctgctcctgggcgccacgctgaccttccgggcgctccggcgcgcgctctgtcgcctgcccctacccgtgcacgtgcgcgccgaccccctgcgcacctggcgctggcacaacctgctcgtctccttcgctcactccattgtgtcggggatctgggcactgctgtgtgtatggcagactcctgacatgttagtggagattgagacggcgtggtcactttctggctatttgctcgtttgcttctctgcggggtatttcatccacgatacggtggacatcgtggctagcggacagacgcgagcctcttgggaataccttgtccatcacgtcatggccatgggtgccttcttctccggcatcttttggagcagctttgtcggtgggggtgtcttaacactactggtggaagtcagcaacatcttcctcaccattcgcatgatgatgaaaatcagtaatgcccaggatcatctcctctaccgggttaacaagtatgtgaacctggtcatgtactttctcttccgcctggcccctcaggcctacctcacccatttcttcttgcgttatgtgaaccagaggaccctgggcaccttcctgctgggtatcctgctcatgctggacgtgatgatcataatctacttttcccgcctcctccgctctgacttctgccctgagcatgtccccaagaagcaacacaaagacaagttcttgactgagtga
Sequence Length
744
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,054 Da
NCBI Official Full Name
Homo sapiens TLC domain containing 1, mRNA
NCBI Official Synonym Full Names
TLC domain containing 1
NCBI Official Symbol
TLCD1
NCBI Protein Information
calfacilitin
UniProt Protein Name
Calfacilitin
Protein Family
UniProt Gene Name
TLCD1
UniProt Entry Name
TLCD1_HUMAN
Uniprot Description
TLCD1: Calcium channel facilitator that increases calcium flux by generating a larger window current and slowing inactivation of the L-type CACNA1C/CaV1.2 channel. Regulation of intracellular calcium by Calfacilitin is required for neural plate formation. Interacts with CACNA1C
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 17q11.2
Similar Products
Product Notes
The TLCD1 tlcd1 (Catalog #AAA1278285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccgac tgctgcaccc cgccctgccg ctgctcctgg gcgccacgct gaccttccgg gcgctccggc gcgcgctctg tcgcctgccc ctacccgtgc acgtgcgcgc cgaccccctg cgcacctggc gctggcacaa cctgctcgtc tccttcgctc actccattgt gtcggggatc tgggcactgc tgtgtgtatg gcagactcct gacatgttag tggagattga gacggcgtgg tcactttctg gctatttgct cgtttgcttc tctgcggggt atttcatcca cgatacggtg gacatcgtgg ctagcggaca gacgcgagcc tcttgggaat accttgtcca tcacgtcatg gccatgggtg ccttcttctc cggcatcttt tggagcagct ttgtcggtgg gggtgtctta acactactgg tggaagtcag caacatcttc ctcaccattc gcatgatgat gaaaatcagt aatgcccagg atcatctcct ctaccgggtt aacaagtatg tgaacctggt catgtacttt ctcttccgcc tggcccctca ggcctacctc acccatttct tcttgcgtta tgtgaaccag aggaccctgg gcaccttcct gctgggtatc ctgctcatgc tggacgtgat gatcataatc tacttttccc gcctcctccg ctctgacttc tgccctgagc atgtccccaa gaagcaacac aaagacaagt tcttgactga gtga. It is sometimes possible for the material contained within the vial of "TLCD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
