Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TIMP3 cdna clone

TIMP3 cDNA Clone

Gene Names
TIMP3; SFD; K222; K222TA2; HSMRK222
Synonyms
TIMP3; TIMP3 cDNA Clone; TIMP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccccttggctcgggctcatcgtgctcctgggcagctggagcctgggggactggggcgccgaggcgtgcacatgctcgcccagccacccccaggacgccttctgcaactccgacatcgtgatccgggccaaggtggtggggaagaagctggtaaaggaggggcccttcggcacgctggtctacaccatcaagcagatgaagatgtaccgaggcttcaccaagatgccccatgtgcagtacatccatacggaagcttccgagagtctctgtggccttaagctggaggtcaacaagtaccagtacctgctgacaggtcgcgtctatgatggcaagatgtacacggggctgtgcaacttcgtggagaggtgggaccagctcaccctctcccagcgcaaggggctgaactatcggtatcacctgggttgtaactgcaagatcaagtcctgctactacctgccttgctttgtgacttccaagaacgagtgtctctggaccgacatgctctccaatttcggttaccctggctaccagtccaaacactacgcctgcatccggcagaagggcggctactgcagctggtaccgaggatgggcccccccggataaaagcatcatcaatgccacagacccctga
Sequence Length
636
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,145 Da
NCBI Official Full Name
Homo sapiens TIMP metallopeptidase inhibitor 3, mRNA
NCBI Official Synonym Full Names
TIMP metallopeptidase inhibitor 3
NCBI Official Symbol
TIMP3
NCBI Official Synonym Symbols
SFD; K222; K222TA2; HSMRK222
NCBI Protein Information
metalloproteinase inhibitor 3
UniProt Protein Name
Metalloproteinase inhibitor 3
UniProt Gene Name
TIMP3
UniProt Synonym Gene Names
TIMP-3
UniProt Entry Name
TIMP3_HUMAN

NCBI Description

This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]

Uniprot Description

TIMP3: Complexes with metalloproteinases (such as collagenases) and irreversibly inactivates them by binding to their catalytic zinc cofactor. May form part of a tissue-specific acute response to remodeling stimuli. Known to act on MMP-1, MMP-2, MMP-3, MMP-7, MMP-9, MMP-13, MMP-14 and MMP-15. Interacts with EFEMP1. Belongs to the protease inhibitor I35 (TIMP) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 22q12.3

Cellular Component: extracellular matrix; extracellular region; extracellular space; nucleus; proteinaceous extracellular matrix

Molecular Function: metalloendopeptidase inhibitor activity; protease binding; protein binding

Biological Process: negative regulation of membrane protein ectodomain proteolysis; platelet degranulation; response to organic substance

Disease: Fundus Dystrophy, Pseudoinflammatory, Of Sorsby

Research Articles on TIMP3

Similar Products

Product Notes

The TIMP3 timp3 (Catalog #AAA1267145) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccctt ggctcgggct catcgtgctc ctgggcagct ggagcctggg ggactggggc gccgaggcgt gcacatgctc gcccagccac ccccaggacg ccttctgcaa ctccgacatc gtgatccggg ccaaggtggt ggggaagaag ctggtaaagg aggggccctt cggcacgctg gtctacacca tcaagcagat gaagatgtac cgaggcttca ccaagatgcc ccatgtgcag tacatccata cggaagcttc cgagagtctc tgtggcctta agctggaggt caacaagtac cagtacctgc tgacaggtcg cgtctatgat ggcaagatgt acacggggct gtgcaacttc gtggagaggt gggaccagct caccctctcc cagcgcaagg ggctgaacta tcggtatcac ctgggttgta actgcaagat caagtcctgc tactacctgc cttgctttgt gacttccaag aacgagtgtc tctggaccga catgctctcc aatttcggtt accctggcta ccagtccaaa cactacgcct gcatccggca gaagggcggc tactgcagct ggtaccgagg atgggccccc ccggataaaa gcatcatcaa tgccacagac ccctga. It is sometimes possible for the material contained within the vial of "TIMP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.