TIMD4 cdna clone
TIMD4 cDNA Clone
Gene Names
TIMD4; TIM4; SMUCKLER
Synonyms
TIMD4; TIMD4 cDNA Clone; TIMD4 cdna clone
Sequence
atgtccaaagaacctctcattctctggctgatgattgagttttggtggctttacctgacaccagtcacttcagagactgttgtgacggaggttttgggtcaccgggtgactttgccctgtctgtactcatcctggtctcacaacagcaacagcatgtgctgggggaaagaccagtgcccctactccggttgcaaggaggcgctcatccgcactgatggaatgagggtgacctcaagaaagtcagcaaaatatagacttcaggggactatcccgagaggtgatgtctccttgaccatcttaaaccccagtgaaagtgacagcggtgtgtactgctgccgcatagaagtgcctggctggttcaacgatgtaaagataaacgtgcgcctgaatctacagagagcctcaacaaccacgcacagaacagcaaccaccaccacacgcagaacaacaacaacaagccccaccaccacccgacaaatgacaacaaccccagctgcacttccaacaacagtcgtgaccacacccgatctcacaaccggaacaccactccagatgacaaccattgccgtcttcacaacagcaaacacgtgcctttcactaaccccaagcacccttccggaggaagccacaggtcttctgactcccgagccttctaaggaagggcccatcctcactgcagaatcagaaactgtcctccccagtgattcctggagtagtgctgagtctacttctgctgacactgtcctgctgacatccaaagagtccaaagtttgggatctcccatcaacatcccacgtgtcaatgtggaaaacgagtgattctgtgtcttctcctcagcctggagcatctgatacagcagttcctgagcagaacaaaacaacaaaaacaggacagatggatggaatacccatgtcaatgaagaatgaaatgcccatctcccaactactgatgatcatcgccccctccttgggatttgtgctcttcgcattgtttgtggcgtttctcctgagagggaaactcatggaaacctattgttcgcagaaacacacaaggctagactacattggagatagtaaaaatgtcctcaatgacgtgcagcatggaagggaagacgaagacggcctttttaccctctaa
Sequence Length
1137
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,536 Da
NCBI Official Full Name
Homo sapiens T-cell immunoglobulin and mucin domain containing 4, mRNA
NCBI Official Synonym Full Names
T-cell immunoglobulin and mucin domain containing 4
NCBI Official Symbol
TIMD4
NCBI Official Synonym Symbols
TIM4; SMUCKLER
NCBI Protein Information
T-cell immunoglobulin and mucin domain-containing protein 4
UniProt Protein Name
T-cell immunoglobulin and mucin domain-containing protein 4
Protein Family
UniProt Gene Name
TIMD4
UniProt Synonym Gene Names
TIM4; TIMD-4; TIM-4
UniProt Entry Name
TIMD4_HUMAN
Uniprot Description
TIM-4: Phosphatidylserine receptor that enhances the engulfment of apoptotic cells. Involved in regulating T-cell proliferation and lymphotoxin signaling. Ligand for HAVCR1/TIMD1. Belongs to the immunoglobulin superfamily. TIM family.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 5q33.3
Research Articles on TIMD4
Similar Products
Product Notes
The TIMD4 timd4 (Catalog #AAA1268412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaaag aacctctcat tctctggctg atgattgagt tttggtggct ttacctgaca ccagtcactt cagagactgt tgtgacggag gttttgggtc accgggtgac tttgccctgt ctgtactcat cctggtctca caacagcaac agcatgtgct gggggaaaga ccagtgcccc tactccggtt gcaaggaggc gctcatccgc actgatggaa tgagggtgac ctcaagaaag tcagcaaaat atagacttca ggggactatc ccgagaggtg atgtctcctt gaccatctta aaccccagtg aaagtgacag cggtgtgtac tgctgccgca tagaagtgcc tggctggttc aacgatgtaa agataaacgt gcgcctgaat ctacagagag cctcaacaac cacgcacaga acagcaacca ccaccacacg cagaacaaca acaacaagcc ccaccaccac ccgacaaatg acaacaaccc cagctgcact tccaacaaca gtcgtgacca cacccgatct cacaaccgga acaccactcc agatgacaac cattgccgtc ttcacaacag caaacacgtg cctttcacta accccaagca cccttccgga ggaagccaca ggtcttctga ctcccgagcc ttctaaggaa gggcccatcc tcactgcaga atcagaaact gtcctcccca gtgattcctg gagtagtgct gagtctactt ctgctgacac tgtcctgctg acatccaaag agtccaaagt ttgggatctc ccatcaacat cccacgtgtc aatgtggaaa acgagtgatt ctgtgtcttc tcctcagcct ggagcatctg atacagcagt tcctgagcag aacaaaacaa caaaaacagg acagatggat ggaataccca tgtcaatgaa gaatgaaatg cccatctccc aactactgat gatcatcgcc ccctccttgg gatttgtgct cttcgcattg tttgtggcgt ttctcctgag agggaaactc atggaaacct attgttcgca gaaacacaca aggctagact acattggaga tagtaaaaat gtcctcaatg acgtgcagca tggaagggaa gacgaagacg gcctttttac cctctaa. It is sometimes possible for the material contained within the vial of "TIMD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
