Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TICAM2 cdna clone

TICAM2 cDNA Clone

Gene Names
TICAM2; TIRP; TRAM; TIRAP3; MyD88-4; TICAM-2
Synonyms
TICAM2; TICAM2 cDNA Clone; TICAM2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGTATCGGGAAGTCTAAAATAAATTCCTGCCCTCTTTCTCTCTCTTGGGGTAAAAGGCACAGTGTGGATACAAGTCCAGGATATCATGAGTCAGATTCCAAGAAGTCTGAAGATCTATCCTTGTGTAATGTTGCTGAGCACAGCAATACAACAGAGGGGCCAACAGGAAAGCAGGAGGGAGCTCAGAGCGTGGAAGAGATGTTTGAAGAAGAAGCTGAAGAAGAGGTGTTCCTCAAATTTGTGATATTGCATGCAGAAGATGACACAGATGAAGCCCTCAGAGTCCAGAATCTGCTACAAGATGACTTTGGTATCAAACCCGGAATAATCTTTGCTGAGATGCCATGTGGCAGACAGCATTTACAGAATTTAGATGATGCTGTAAATGGGTCTGCATGGACAATCTTATTACTGACTGAAAACTTTTTAAGAGATACTTGGTGTAATTTCCAGTTCTATACGTCCCTAATGAACTCCGTTAACAGGCAGCATAAATACAACTCTGTTATACCCATGCGGCCCCTGAACAATCCCCTTCCCCGAGAAAGGACTCCCTTTGCCCTCCAAACCATCAATGCCTTAGAGGAAGAAAGTCGTGGATTTCCTACACAAGTAGAAAGAATTTTTCAGGAGTCTGTGTATAAGACACAACAAACTATATGGAAAGAGACAAGAAATATGGTACAAAGACAATTTATTGCCTGA
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,173 Da
NCBI Official Full Name
Homo sapiens toll-like receptor adaptor molecule 2, mRNA
NCBI Official Synonym Full Names
toll like receptor adaptor molecule 2
NCBI Official Symbol
TICAM2
NCBI Official Synonym Symbols
TIRP; TRAM; TIRAP3; MyD88-4; TICAM-2
NCBI Protein Information
TIR domain-containing adapter molecule 2
UniProt Protein Name
TIR domain-containing adapter molecule 2
UniProt Gene Name
TICAM2
UniProt Synonym Gene Names
TIRAP3; TIRP; TRAM; TICAM-2; MyD88-4
UniProt Entry Name
TCAM2_HUMAN

NCBI Description

TIRP is a Toll/interleukin-1 receptor (IL1R; MIM 147810) (TIR) domain-containing adaptor protein involved in Toll receptor signaling (see TLR4; MIM 603030).[supplied by OMIM, Apr 2004]

Uniprot Description

Functions as sorting adapter in LPS-TLR4 signaling to regulate the MYD88-independent pathway during the innate immune response to LPS. Physically bridges TLR4 and TICAM1 and functionally transmits LPS-TRL4 signal to TICAM1; signaling is proposed to occur in early endosomes after endocytosis of TLR4. May also be involved in IL1-triggered NF-kappa-B activation, functioning upstream of IRAK1, IRAK2, TRAF6, and IKBKB; however, reports are controversial. Involved in IL-18 signaling and is proposed to function as a sorting adaptor for MYD88 in IL-18 signaling during adaptive immune response.

Research Articles on TICAM2

Similar Products

Product Notes

The TICAM2 ticam2 (Catalog #AAA1270737) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGTATCG GGAAGTCTAA AATAAATTCC TGCCCTCTTT CTCTCTCTTG GGGTAAAAGG CACAGTGTGG ATACAAGTCC AGGATATCAT GAGTCAGATT CCAAGAAGTC TGAAGATCTA TCCTTGTGTA ATGTTGCTGA GCACAGCAAT ACAACAGAGG GGCCAACAGG AAAGCAGGAG GGAGCTCAGA GCGTGGAAGA GATGTTTGAA GAAGAAGCTG AAGAAGAGGT GTTCCTCAAA TTTGTGATAT TGCATGCAGA AGATGACACA GATGAAGCCC TCAGAGTCCA GAATCTGCTA CAAGATGACT TTGGTATCAA ACCCGGAATA ATCTTTGCTG AGATGCCATG TGGCAGACAG CATTTACAGA ATTTAGATGA TGCTGTAAAT GGGTCTGCAT GGACAATCTT ATTACTGACT GAAAACTTTT TAAGAGATAC TTGGTGTAAT TTCCAGTTCT ATACGTCCCT AATGAACTCC GTTAACAGGC AGCATAAATA CAACTCTGTT ATACCCATGC GGCCCCTGAA CAATCCCCTT CCCCGAGAAA GGACTCCCTT TGCCCTCCAA ACCATCAATG CCTTAGAGGA AGAAAGTCGT GGATTTCCTA CACAAGTAGA AAGAATTTTT CAGGAGTCTG TGTATAAGAC ACAACAAACT ATATGGAAAG AGACAAGAAA TATGGTACAA AGACAATTTA TTGCCTGA. It is sometimes possible for the material contained within the vial of "TICAM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.