Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TIA1 cdna clone

TIA1 cDNA Clone

Gene Names
TIA1; WDM; TIA-1
Synonyms
TIA1; TIA1 cDNA Clone; TIA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgcagctgcagcattagctgctatgaatggacggaagataatgggtaaggaagtcaaagtgaattgggcaacaacccctagcagtcaaaagaaagatacaagcagtagtaccgttgtcagcacacagcgttcacaagatcatttccatgtctttgttggtgatctcagcccagaaattacaactgaagatataaaagctgcttttgcaccatttggaagaatatcagatgcccgagtggtaaaagacatggcaacaggaaagtctaagggatatggctttgtctcctttttcaacaaatgggatgctgaaaacgccattcaacagatgggtggccagtggcttggtggaagacaaatcagaactaactgggcaacccgaaagcctcccgctccaaagagtacatatgagtgtaggtgtattggagaagaaaaggaaatgtggaattttggagaaaaatacgctagattttaa
Sequence Length
645
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,062 Da
NCBI Official Full Name
Homo sapiens TIA1 cytotoxic granule-associated RNA binding protein, mRNA
NCBI Official Synonym Full Names
TIA1 cytotoxic granule associated RNA binding protein
NCBI Official Symbol
TIA1
NCBI Official Synonym Symbols
WDM; TIA-1
NCBI Protein Information
nucleolysin TIA-1 isoform p40
UniProt Protein Name
Nucleolysin TIA-1 isoform p40
Protein Family
UniProt Gene Name
TIA1
UniProt Synonym Gene Names
TIA-1
UniProt Entry Name
TIA1_HUMAN

NCBI Description

The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]

Uniprot Description

TIA1: Involved in alternative pre-RNA splicing and regulation of mRNA translation by binding to AU-rich elements (AREs) located in mRNA 3' untranslated regions (3' UTRs). Possesses nucleolytic activity against cytotoxic lymphocyte target cells. May be involved in apoptosis. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; Translation

Chromosomal Location of Human Ortholog: 2p13

Cellular Component: cytoplasm; nucleoplasm; stress granule

Molecular Function: poly(A) binding; protein binding

Biological Process: fibroblast growth factor receptor signaling pathway; regulation of nuclear mRNA splicing, via spliceosome

Disease: Welander Distal Myopathy

Research Articles on TIA1

Similar Products

Product Notes

The TIA1 tia1 (Catalog #AAA1269510) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggacg agatgcccaa gactctatac gtcggtaacc tttccagaga tgtgacagaa gctctaattc tgcaactctt tagccagatt ggaccttgta aaaactgcaa aatgattatg gatacagctg gaaatgatcc ctattgtttt gtggagtttc atgagcatcg tcatgcagct gcagcattag ctgctatgaa tggacggaag ataatgggta aggaagtcaa agtgaattgg gcaacaaccc ctagcagtca aaagaaagat acaagcagta gtaccgttgt cagcacacag cgttcacaag atcatttcca tgtctttgtt ggtgatctca gcccagaaat tacaactgaa gatataaaag ctgcttttgc accatttgga agaatatcag atgcccgagt ggtaaaagac atggcaacag gaaagtctaa gggatatggc tttgtctcct ttttcaacaa atgggatgct gaaaacgcca ttcaacagat gggtggccag tggcttggtg gaagacaaat cagaactaac tgggcaaccc gaaagcctcc cgctccaaag agtacatatg agtgtaggtg tattggagaa gaaaaggaaa tgtggaattt tggagaaaaa tacgctagat tttaa. It is sometimes possible for the material contained within the vial of "TIA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.