Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TGIF2LX cdna clone

TGIF2LX cDNA Clone

Gene Names
TGIF2LX; TGIFLX
Synonyms
TGIF2LX; TGIF2LX cDNA Clone; TGIF2LX cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccgctgcggacggcccggctgagacccaaagcccggtggaaaaagacagcccggcgaagacccaaagcccagcccaagacacctcaatcatgtcgagaaataacgcagatacaggcagagttcttgccttaccagagcacaagaagaagcgcaagggaaacttgccagccgagtccgttaagatcctccgcgactggatgtataagcatcggtttaaggcctacccttcagaagaagagaagcaaatgctgtcagagaagaccaatttgtctttgttgcagatttctaactggtttatcaatgctcgcagacgcattctcccggatatgcttcaacagcgtagaaacgaccccatcattggccacaaaacgggcaaagatgcccatgccacccacctgcagagcaccgaggcgtctgtgccggccaagtcagggcccagtggtccagacaatgtacaaagcctgcccctgtggcccttgccaaagggccagatgtcaagagagaagcaaccagatccggagtcggcccctagccagaagctcaccggaatagcccagccgaagaaaaaggtcaaggtttctatcacatccccgtcttctccagaacttgtgtctccagaggagcacgccgacttcagcagcttcctgctgctagtcgatgcagcagtacaaagggctgccgagctggagctagagaagaagcaagagcctaatccatga
Sequence Length
726
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,675 Da
NCBI Official Full Name
Homo sapiens TGFB-induced factor homeobox 2-like, X-linked, mRNA
NCBI Official Synonym Full Names
TGFB induced factor homeobox 2 like, X-linked
NCBI Official Symbol
TGIF2LX
NCBI Official Synonym Symbols
TGIFLX
NCBI Protein Information
homeobox protein TGIF2LX
UniProt Protein Name
Homeobox protein TGIF2LX
Protein Family
UniProt Gene Name
TGIF2LX
UniProt Synonym Gene Names
TGIFLX
UniProt Entry Name
TF2LX_HUMAN

NCBI Description

This gene encodes a member of the TALE/TGIF homeobox family of transcription factors. Testis-specific expression suggests that this gene may play a role in spermatogenesis. A homolog of this gene lies within the male specific region of chromosome Y, in a block of sequence that is thought to be the result of a large X-to-Y transposition. [provided by RefSeq, Jul 2008]

Uniprot Description

TGIF2LX: May have a transcription role in testis. Belongs to the TALE/TGIF homeobox family.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: Xq21.31

Research Articles on TGIF2LX

Similar Products

Product Notes

The TGIF2LX tgif2lx (Catalog #AAA1271799) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccg ctgcggacgg cccggctgag acccaaagcc cggtggaaaa agacagcccg gcgaagaccc aaagcccagc ccaagacacc tcaatcatgt cgagaaataa cgcagataca ggcagagttc ttgccttacc agagcacaag aagaagcgca agggaaactt gccagccgag tccgttaaga tcctccgcga ctggatgtat aagcatcggt ttaaggccta cccttcagaa gaagagaagc aaatgctgtc agagaagacc aatttgtctt tgttgcagat ttctaactgg tttatcaatg ctcgcagacg cattctcccg gatatgcttc aacagcgtag aaacgacccc atcattggcc acaaaacggg caaagatgcc catgccaccc acctgcagag caccgaggcg tctgtgccgg ccaagtcagg gcccagtggt ccagacaatg tacaaagcct gcccctgtgg cccttgccaa agggccagat gtcaagagag aagcaaccag atccggagtc ggcccctagc cagaagctca ccggaatagc ccagccgaag aaaaaggtca aggtttctat cacatccccg tcttctccag aacttgtgtc tccagaggag cacgccgact tcagcagctt cctgctgcta gtcgatgcag cagtacaaag ggctgccgag ctggagctag agaagaagca agagcctaat ccatga. It is sometimes possible for the material contained within the vial of "TGIF2LX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.