Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TGFBR2 cdna clone

TGFBR2 cDNA Clone

Gene Names
TGFBR2; AAT3; FAA3; LDS2; MFS2; RIIC; LDS1B; LDS2B; TAAD2; TGFR-2; TGFbeta-RII
Synonyms
TGFBR2; TGFBR2 cDNA Clone; TGFBR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtcgggggctgctcaggggcctgtggccgctgcacatcgtcctgtggacgcgtatcgccagcacgatcccaccgcacgttcagaagtcggttaataacgacatgatagtcactgacaacaacggtgcagtcaagtttccacaactgtgtaaattttgtgatgtgagattttccacctgtgacaaccagaaatcctgcatgagcaactgcagcatcacctccatctgtgagaagccacaggaagtctgtgtggctgtatggagaaagaatgacgagaacataacactagagacagtttgccatgaccccaagctcccctaccatgactttattctggaagatgctgcttctccaaagtgcattatgaaggaaaaaaaaaagcctggtgagactttcttcatgtgttcctgtagctctgatgagtgcaatgacaacatcatcttctcagaagaatataacaccagcaatcctgacttgttgctagtcatatttcaagtgacaggcatcagcctcctgccaccactgggagttgccatatctgtcatcatcatcttctactgctaccgcgttaaccggcagcagaagctgagttcaacctgggaaaccggcaagacgcggaagctcatggagttcagcgagcactgtgccatcatcctggaagatgaccgctctgacatcagctccacgtgtgccaacaacatcaaccacaacacagagctgctgcccattgagctggacaccctggtggggaaaggtcgctttgctgaggtctataaggccaagctgaagcagaacacttcagagcagtttgagacagtggcagtcaagatctttccctatgaggagtatgcctcttggaagacagagaaggacatcttctcagacatcaatctgaagcatgagaacatactccagttcctgacggctgaggagcggaagacggagttggggaaacaatactggctgatcaccgccttccacgccaagggcaacctacagtag
Sequence Length
1005
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,457 Da
NCBI Official Full Name
Homo sapiens transforming growth factor, beta receptor II (70/80kDa), mRNA
NCBI Official Synonym Full Names
transforming growth factor beta receptor 2
NCBI Official Symbol
TGFBR2
NCBI Official Synonym Symbols
AAT3; FAA3; LDS2; MFS2; RIIC; LDS1B; LDS2B; TAAD2; TGFR-2; TGFbeta-RII
NCBI Protein Information
TGF-beta receptor type-2
UniProt Protein Name
TGF-beta receptor type-2
Protein Family
UniProt Gene Name
TGFBR2
UniProt Synonym Gene Names
TGFR-2; TGF-beta receptor type II; TbetaR-II
UniProt Entry Name
TGFR2_HUMAN

NCBI Description

This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

TGFBR2: a TKL kinase of the serine/threonine-protein kinase receptor (STKR) family. R1 and R2 TGF-beta receptors dimerize after binding TGF-beta at the cell surface. Binds to DAXX. Defects can cause esophageal cancer.

Protein type: Oncoprotein; Protein kinase, Ser/Thr (receptor); Kinase, protein; EC 2.7.11.30; Membrane protein, integral; Protein kinase, TKL; TKL group; STKR family; Type2 subfamily

Chromosomal Location of Human Ortholog: 3p22

Cellular Component: caveola; cytosol; external side of plasma membrane; integral to membrane; lipid raft; plasma membrane; receptor complex

Molecular Function: glycosaminoglycan binding; protein binding; SMAD binding; transforming growth factor beta binding; transforming growth factor beta receptor activity; transmembrane receptor protein serine/threonine kinase activity

Biological Process: activation of protein kinase activity; apoptosis; blood vessel development; brain development; embryonic cranial skeleton morphogenesis; embryonic hemopoiesis; heart development; heart looping; myeloid dendritic cell differentiation; negative regulation of transforming growth factor beta receptor signaling pathway; palate development; patterning of blood vessels; peptidyl-serine phosphorylation; peptidyl-threonine phosphorylation; positive regulation of B cell tolerance induction; positive regulation of cell proliferation; positive regulation of mesenchymal cell proliferation; positive regulation of NK T cell differentiation; positive regulation of T cell tolerance induction; positive regulation of tolerance induction to self antigen; protein amino acid phosphorylation; regulation of cell proliferation; response to drug; transforming growth factor beta receptor signaling pathway; vasculogenesis

Disease: Colorectal Cancer, Hereditary Nonpolyposis, Type 6; Esophageal Cancer; Loeys-dietz Syndrome 2

Research Articles on TGFBR2

Similar Products

Product Notes

The TGFBR2 tgfbr2 (Catalog #AAA1269867) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcggg ggctgctcag gggcctgtgg ccgctgcaca tcgtcctgtg gacgcgtatc gccagcacga tcccaccgca cgttcagaag tcggttaata acgacatgat agtcactgac aacaacggtg cagtcaagtt tccacaactg tgtaaatttt gtgatgtgag attttccacc tgtgacaacc agaaatcctg catgagcaac tgcagcatca cctccatctg tgagaagcca caggaagtct gtgtggctgt atggagaaag aatgacgaga acataacact agagacagtt tgccatgacc ccaagctccc ctaccatgac tttattctgg aagatgctgc ttctccaaag tgcattatga aggaaaaaaa aaagcctggt gagactttct tcatgtgttc ctgtagctct gatgagtgca atgacaacat catcttctca gaagaatata acaccagcaa tcctgacttg ttgctagtca tatttcaagt gacaggcatc agcctcctgc caccactggg agttgccata tctgtcatca tcatcttcta ctgctaccgc gttaaccggc agcagaagct gagttcaacc tgggaaaccg gcaagacgcg gaagctcatg gagttcagcg agcactgtgc catcatcctg gaagatgacc gctctgacat cagctccacg tgtgccaaca acatcaacca caacacagag ctgctgccca ttgagctgga caccctggtg gggaaaggtc gctttgctga ggtctataag gccaagctga agcagaacac ttcagagcag tttgagacag tggcagtcaa gatctttccc tatgaggagt atgcctcttg gaagacagag aaggacatct tctcagacat caatctgaag catgagaaca tactccagtt cctgacggct gaggagcgga agacggagtt ggggaaacaa tactggctga tcaccgcctt ccacgccaag ggcaacctac agtag. It is sometimes possible for the material contained within the vial of "TGFBR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.