Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TGFB1I1 cdna clone

TGFB1I1 cDNA Clone

Gene Names
TGFB1I1; HIC5; ARA55; HIC-5; TSC-5
Synonyms
TGFB1I1; TGFB1I1 cDNA Clone; TGFB1I1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccaaggtcaggggctcccaaagagcgccctgcggagcctctcacccctcccccatcctatggccaccagccacagacagggtctggggagtcttcaggagcctcgggggacaaggaccacctgtacagcacggtatgcaagcctcggtccccaaagcctgcagccccggcggcccctccattctcctcttccagcggtgtcttgggtaccgggctctgtgagctagatcggttgcttcaggaacttaatgccactcagttcaacatcacagatgaaatcatgtctcagttcccatctagcaaggtggcttcaggagagcagaaggaggaccagtctgaagataagaaaagacccagcctcccttccagcccgtctcctggcctcccaaaggcttctgccacctcagccactctggagctggatagactgatggcctcactctctgacttccgcgttcaaaaccatcttccagcctctgggccaactcagccaccggtggtgagctccacaaatgagggctccccatccccaccagagccgactggcaagggcagcctagacaccatgctggggctgctgcagtccgacctcagccgccggggtgttcccacccaggccaaaggcctctgtggctcctgcaataaacctattgctgggcaagtggtgacggctctgggccgcgcctggcaccccgagcacttcgtttgcggaggctgttccaccgccctgggaggcagcagcttcttcgagaaggatggagcccccttctgccccgagtgctactttgagcgcttctcgccaagatgtggcttctgcaaccagcccatccgacacaagatggtgaccgccttgggcactcactggcacccagagcatttctgctgcgtcagttgcggggagcccttcggagatgagggtttccacgagcgcgagggccgcccctactgccgccgggacttcctgcagctgttcgccccgcgctgccagggctgccagggccccatcctggataactacatctcggcgctcagcgcgctctggcacccggactgtttcgtctgcagggaatgcttcgcgcccttctcgggaggcagctttttcgagcacgagggccgcccgttgtgcgagaaccacttccacgcacgacgcggctcgctgtgcgccacgtgtggcctccctgtgaccggccgctgcgtgtcggccctgggtcgccgcttccacccggaccacttcacatgcaccttctgcctgcgcccgctcaccaaggggtccttccaggagcgcgccggcaagccctactgccagccctgcttcctgaagctcttcggctga
Sequence Length
1335
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,941 Da
NCBI Official Full Name
Homo sapiens transforming growth factor beta 1 induced transcript 1, mRNA
NCBI Official Synonym Full Names
transforming growth factor beta 1 induced transcript 1
NCBI Official Symbol
TGFB1I1
NCBI Official Synonym Symbols
HIC5; ARA55; HIC-5; TSC-5
NCBI Protein Information
transforming growth factor beta-1-induced transcript 1 protein
UniProt Protein Name
Transforming growth factor beta-1-induced transcript 1 protein
UniProt Gene Name
TGFB1I1
UniProt Synonym Gene Names
ARA55; Hic-5
UniProt Entry Name
TGFI1_HUMAN

NCBI Description

This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

Hic-5: Functions as a molecular adapter coordinating multiple protein-protein interactions at the focal adhesion complex and in the nucleus. Links various intracellular signaling modules to plasma membrane receptors and regulates the Wnt and TGFB signaling pathways. May also regulate SLC6A3 and SLC6A4 targeting to the plasma membrane hence regulating their activity. In the nucleus, functions as a nuclear receptor coactivator regulating glucocorticoid, androgen, mineralocorticoid and progesterone receptor transcriptional activity. May play a role in the processes of cell growth, proliferation, migration, differentiation and senescence. May have a zinc-dependent DNA- binding activity. Homooligomer. Interacts with CRIP2, HSPB1, ILK, LIMS1, LIMS2, NCK2, NUDT16L1, PAK, PPARG, PTPN12, TCF3, TCF7L2 and VCL. Forms a complex with GIT1 and ARHGEF7. Interacts with AR/androgen receptor in a ligand-dependent manner. Interacts with CSK, LYN, MAPK15, NR3C1, PPARG, PTK2/FAK1, PTK2B/PYK2, SLC6A3, SLC6A4, SMAD3, SRC and talin. Up-regulated by TNF and hydrogen peroxide. Expressed in platelets, smooth muscle and prostate stromal cells. Belongs to the paxillin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: extracellular matrix; focal adhesion; intracellular

Molecular Function: androgen receptor binding; protein binding; Roundabout binding; transcription coactivator activity

Biological Process: cell adhesion; negative regulation of cell proliferation; negative regulation of transforming growth factor beta receptor signaling pathway; positive regulation of transcription, DNA-dependent; positive regulation of transforming growth factor beta receptor signaling pathway; transcription from RNA polymerase II promoter; ubiquitin-dependent SMAD protein catabolic process

Research Articles on TGFB1I1

Similar Products

Product Notes

The TGFB1I1 tgfb1i1 (Catalog #AAA1269327) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaaggt caggggctcc caaagagcgc cctgcggagc ctctcacccc tcccccatcc tatggccacc agccacagac agggtctggg gagtcttcag gagcctcggg ggacaaggac cacctgtaca gcacggtatg caagcctcgg tccccaaagc ctgcagcccc ggcggcccct ccattctcct cttccagcgg tgtcttgggt accgggctct gtgagctaga tcggttgctt caggaactta atgccactca gttcaacatc acagatgaaa tcatgtctca gttcccatct agcaaggtgg cttcaggaga gcagaaggag gaccagtctg aagataagaa aagacccagc ctcccttcca gcccgtctcc tggcctccca aaggcttctg ccacctcagc cactctggag ctggatagac tgatggcctc actctctgac ttccgcgttc aaaaccatct tccagcctct gggccaactc agccaccggt ggtgagctcc acaaatgagg gctccccatc cccaccagag ccgactggca agggcagcct agacaccatg ctggggctgc tgcagtccga cctcagccgc cggggtgttc ccacccaggc caaaggcctc tgtggctcct gcaataaacc tattgctggg caagtggtga cggctctggg ccgcgcctgg caccccgagc acttcgtttg cggaggctgt tccaccgccc tgggaggcag cagcttcttc gagaaggatg gagccccctt ctgccccgag tgctactttg agcgcttctc gccaagatgt ggcttctgca accagcccat ccgacacaag atggtgaccg ccttgggcac tcactggcac ccagagcatt tctgctgcgt cagttgcggg gagcccttcg gagatgaggg tttccacgag cgcgagggcc gcccctactg ccgccgggac ttcctgcagc tgttcgcccc gcgctgccag ggctgccagg gccccatcct ggataactac atctcggcgc tcagcgcgct ctggcacccg gactgtttcg tctgcaggga atgcttcgcg cccttctcgg gaggcagctt tttcgagcac gagggccgcc cgttgtgcga gaaccacttc cacgcacgac gcggctcgct gtgcgccacg tgtggcctcc ctgtgaccgg ccgctgcgtg tcggccctgg gtcgccgctt ccacccggac cacttcacat gcaccttctg cctgcgcccg ctcaccaagg ggtccttcca ggagcgcgcc ggcaagccct actgccagcc ctgcttcctg aagctcttcg gctga. It is sometimes possible for the material contained within the vial of "TGFB1I1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.