Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TFRC cdna clone

TFRC cDNA Clone

Gene Names
TFRC; T9; TR; TFR; p90; CD71; TFR1; TRFR; IMD46
Synonyms
TFRC; TFRC cDNA Clone; TFRC cdna clone
Ordering
For Research Use Only!
Sequence
atgatggatcaagctagatcagcattctctaacttgtttggtggagaaccattgtcatatacccggttcagcctggctcggcaagtagatggcgataacagtcatgtggagatgaaacttgctgtagatgaagaagaaaatgctgacaataacacaaaggccaatgtcacaaaaccaaaaaggtgtagtggaagtatctgctatgggactattgctgtgatcgtctttttcttgattggatttatgattggctacttgggctattgtaaaggggtagaaccaaaaactgagtgtgagagactggcaggaaccgagtctccagtgagggaggagccaggagaggacttccctgcagcacgtcgcttatattgggatgacctgaagagaaagttgtcggagaaactggacagcacagacttcaccggcaccatcaagctgctgaatgaaaattcatatgtccctcgtgaggctggatctcaaaaagatgaaaatcttgcgttgtatgttgaaaatcaatttcgtgaatttaaactcagcaaagtctggcgtgatcaacattttgttaagattcaggtcaaagacagcgctcaaaactcggtgatcatagttgataagaacggtagacttgtttacctggtggagaatcctgggggttatgtggcgtatagtaaggctgcaacagttactggtaaactggtccatgctaattttggtactaaaaaagattttgaggatttatacactcctgtgaatggatctatagtgattgtcagagcagggaaaatcacctttgcagaaaaggttgcaaatgctgaaagcttaaatgcaattggtgtgttgatatacatggaccagactaaatttcccattgttaacgcagaactttcattctttggacatgctcatctggggacaggtgacccttacacacctggattcccttccttcaatcacactcagtttccaccatctcggtcatcaggattgcctaatatacctgtccagacaatctccagagctgctgcagaaaagctgtttgggaatatggaaggagactgtccctctgactggaaaacagactctacatgtaggatggtaacctcagaaagcaagaatgtgaagctcactgtgagcaatgtgctgaaagagataaaaattcttaacatctttggagttattaaaggctttgtagaaccagatcactatgttgtagttggggcccagagagatgcatggggccctggagctgcaaaatccggtgtaggcacagctctcctattgaaacttgcccagatgttctcagatatggtcttaaaagatgggtttcagcccagcagaagcattatctttgccagttggagtgctggagactttggatcggttggtgccactgaatggctagagggatacctttcgtccctgcatttaaaggctttcacttatattaatctggataaagcggttcttggtaccagcaacttcaaggtttctgccagcccactgttgtatacgcttattgagaaaacaatgcaaaatgtgaagcatccggttactgggcaatttctatatcaggacagcaactgggccagcaaagttgagaaactcactttagacaatgctgctttccctttccttgcatattctggaatcccagcagtttctttctgtttttgcgaggacacagattatccttatttgggtaccaccatggacacctataaggaactgattgagaggattcctgagttgaacaaagtggcacgagcagctgcagaggtcgctggtcagttcgtgattaaactaacccatgatgttgaattgaacctggactatgagaggtacaacagccaactgctttcatttgtgagggatctgaaccaatacagagcagacataaaggaaatgggcctgagtttacagtggctgtattctgctcgtggagacttcttccgtgctacttccagactaacaacagatttcgggaatgctgagaaaacagacagatttgtcatgaagaaactcaatgatcgtgtcatgagagtggagtatcacttcctctctccctacgtatctccaaaagagtctcctttccgacatgtcttctggggctccggctctcacacgctgccagctttactggagaacttgaaactgcgtaaacaaaataacggtgcttttaatgaaacgctgttcagaaaccagttggctctagctacttggactattcagggagctgcaaatgccctctctggtgacgtttgggacattgacaatgagttttaa
Sequence Length
2283
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,871 Da
NCBI Official Full Name
Homo sapiens transferrin receptor (p90, CD71), mRNA
NCBI Official Synonym Full Names
transferrin receptor
NCBI Official Symbol
TFRC
NCBI Official Synonym Symbols
T9; TR; TFR; p90; CD71; TFR1; TRFR; IMD46
NCBI Protein Information
transferrin receptor protein 1
UniProt Protein Name
Transferrin receptor protein 1
UniProt Gene Name
TFRC
UniProt Synonym Gene Names
TR; TfR; TfR1; Trfr; sTfR
UniProt Entry Name
TFR1_HUMAN

NCBI Description

This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Multiple alternatively spliced variants have been identified. [provided by RefSeq, Sep 2015]

Uniprot Description

TfR: the transferrin receptor. Regulates the cellular uptake of iron occurs via receptor-mediated endocytosis of ligand-occupied receptors into specialized endosomes. Endosomal acidification leads to iron release. The apotransferrin-receptor complex is then recycled to the cell surface with a return to neutral pH and the concomitant loss of affinity of apotransferrin for its receptor. Transferrin receptor is necessary for development of erythrocytes and the nervous system.

Protein type: Membrane protein, integral; Cell surface; Receptor, misc.

Chromosomal Location of Human Ortholog: 3q29

Cellular Component: basolateral plasma membrane; cell surface; coated pit; cytoplasmic membrane-bound vesicle; endosome; external side of plasma membrane; extracellular region; extracellular space; integral to plasma membrane; intracellular membrane-bound organelle; perinuclear region of cytoplasm; plasma membrane; recycling endosome

Molecular Function: double-stranded RNA binding; glycoprotein binding; identical protein binding; protein binding; protein homodimerization activity; transferrin receptor activity; transferrin transmembrane transporter activity

Biological Process: positive regulation of B cell proliferation; positive regulation of isotype switching; positive regulation of T cell proliferation; receptor internalization; regulation of cell growth; regulation of cell proliferation; transferrin transport

Disease: Immunodeficiency 46

Research Articles on TFRC

Similar Products

Product Notes

The TFRC tfrc (Catalog #AAA1270061) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggatc aagctagatc agcattctct aacttgtttg gtggagaacc attgtcatat acccggttca gcctggctcg gcaagtagat ggcgataaca gtcatgtgga gatgaaactt gctgtagatg aagaagaaaa tgctgacaat aacacaaagg ccaatgtcac aaaaccaaaa aggtgtagtg gaagtatctg ctatgggact attgctgtga tcgtcttttt cttgattgga tttatgattg gctacttggg ctattgtaaa ggggtagaac caaaaactga gtgtgagaga ctggcaggaa ccgagtctcc agtgagggag gagccaggag aggacttccc tgcagcacgt cgcttatatt gggatgacct gaagagaaag ttgtcggaga aactggacag cacagacttc accggcacca tcaagctgct gaatgaaaat tcatatgtcc ctcgtgaggc tggatctcaa aaagatgaaa atcttgcgtt gtatgttgaa aatcaatttc gtgaatttaa actcagcaaa gtctggcgtg atcaacattt tgttaagatt caggtcaaag acagcgctca aaactcggtg atcatagttg ataagaacgg tagacttgtt tacctggtgg agaatcctgg gggttatgtg gcgtatagta aggctgcaac agttactggt aaactggtcc atgctaattt tggtactaaa aaagattttg aggatttata cactcctgtg aatggatcta tagtgattgt cagagcaggg aaaatcacct ttgcagaaaa ggttgcaaat gctgaaagct taaatgcaat tggtgtgttg atatacatgg accagactaa atttcccatt gttaacgcag aactttcatt ctttggacat gctcatctgg ggacaggtga cccttacaca cctggattcc cttccttcaa tcacactcag tttccaccat ctcggtcatc aggattgcct aatatacctg tccagacaat ctccagagct gctgcagaaa agctgtttgg gaatatggaa ggagactgtc cctctgactg gaaaacagac tctacatgta ggatggtaac ctcagaaagc aagaatgtga agctcactgt gagcaatgtg ctgaaagaga taaaaattct taacatcttt ggagttatta aaggctttgt agaaccagat cactatgttg tagttggggc ccagagagat gcatggggcc ctggagctgc aaaatccggt gtaggcacag ctctcctatt gaaacttgcc cagatgttct cagatatggt cttaaaagat gggtttcagc ccagcagaag cattatcttt gccagttgga gtgctggaga ctttggatcg gttggtgcca ctgaatggct agagggatac ctttcgtccc tgcatttaaa ggctttcact tatattaatc tggataaagc ggttcttggt accagcaact tcaaggtttc tgccagccca ctgttgtata cgcttattga gaaaacaatg caaaatgtga agcatccggt tactgggcaa tttctatatc aggacagcaa ctgggccagc aaagttgaga aactcacttt agacaatgct gctttccctt tccttgcata ttctggaatc ccagcagttt ctttctgttt ttgcgaggac acagattatc cttatttggg taccaccatg gacacctata aggaactgat tgagaggatt cctgagttga acaaagtggc acgagcagct gcagaggtcg ctggtcagtt cgtgattaaa ctaacccatg atgttgaatt gaacctggac tatgagaggt acaacagcca actgctttca tttgtgaggg atctgaacca atacagagca gacataaagg aaatgggcct gagtttacag tggctgtatt ctgctcgtgg agacttcttc cgtgctactt ccagactaac aacagatttc gggaatgctg agaaaacaga cagatttgtc atgaagaaac tcaatgatcg tgtcatgaga gtggagtatc acttcctctc tccctacgta tctccaaaag agtctccttt ccgacatgtc ttctggggct ccggctctca cacgctgcca gctttactgg agaacttgaa actgcgtaaa caaaataacg gtgcttttaa tgaaacgctg ttcagaaacc agttggctct agctacttgg actattcagg gagctgcaaa tgccctctct ggtgacgttt gggacattga caatgagttt taa. It is sometimes possible for the material contained within the vial of "TFRC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.