TFIP11 cdna clone
TFIP11 cDNA Clone
Gene Names
TFIP11; NTR1; TIP39; hNtr1; Spp382; bK445C9.6
Synonyms
TFIP11; TFIP11 cDNA Clone; TFIP11 cdna clone
Sequence
atgtcattgtcccacttataccgggatggggaaggccgcattgatgatgatgatgacgagcgggagaactttgagatcactgactgggatctccagaatgagttcaaccccaaccgacagcgccactggcagaccaaggaagaagccacctacggggtgtgggcagagcgagactcggatgatgagaggcccagctttggaggcaaacgggcccgtgactactctgcgccagtcaacttcatcagcgcagggctcaagaaaggggcagcggaggaggcagagttggaagattctgatgacgaagagaaacctgttaagcaggacgactttcctaaggattttggaccaaggaagctaaaaacgggtggcaattttaagcccagccagaaaggttttgcaggaggaaccaaatctttcatggacttcggcagctgggaaagacacacaaaaggaattggacagaagcttcttcagaagatgggctacgtccctggacggggcctcgggaagaatgcacaaggtatcattaacccaattgaagccaagcagagaaagggaaaaggtgctgtgggggcttatggatccgagcgcaccactcagtccatgcaagacttccctgtggttgactcagaggaagaagctgaagaggagtttcagaaggagctgagccagtggaggaaagacccaagtggaagcaagaagaagcccaaatactcttacaagaccgtggaagagttgaaggccaagggcaggattagcaagaagctcactgctccccagaaggaactttctcaagtcaaggtcatagacatgacaggccgggagcagaaggtctactacagctacagtcagatcagccacaagcacaacgttcccgatgatgggctgccgctacagtcccaacagctgccacagtctggcaaagaggccaaggcccccggcttcgcgctgcccgagctggagcacaacctgcagctgctcatcgacctcacggagcaggagatcatccagaatgaccggcagctacagtatgagcgggacatggtggtcaacctcttccacgagctggagaagatgaccgaggtcctggaccacgaggagcgggtcatctcgaacctcagcaaggtcctggagatggtggaggagtgcgagcggcggatgcagcccgactgcagcaaccccctcaccctggacgagtgtgcccgcatcttcgaaaccctgcaggacaagtactatgaggagtacaggatgtccgaccgtgtggaccttgctgtggccatcgtctatccactcatgaaggagtacttcaaggagtgggatcccctcaaagactgcacttatggcaccgagatcatctctaagtggaaaagcctcctagagaatgaccagctcttgtcccatggcggacaggacctctcagcagatgcctttcacaggttgatatgggaagtctggatgccttttgttcgaaatattgtcacccagtggcagccaaggaactgtgacccgatggtggactttttggatagttgggtgcacattattcctgtgtggatcttagataacatactggaccaactcatcttccccaagctgcaaaaggaggtggaaaactggaacccgctcacagacactgttcccatccactcttggatccacccatggctgccccttatgcaggcacggctggagccactctattcccccatccgtagtaagctgtccagcgccctgcagaagtggcaccccagcgactcctctgccaagctcatcctccagccctggaaggatgtcttcactcctggctcctgggaagcattcatggtcaaaaacatagtgcccaagctggggatgtgtcttggtgagctagtcattaacccccaccagcagcacatggatgcattctattgggtgattgactgggaagggatgatctctgtctctagcctggtgggacttcttgaaaagcacttcttccccaagtggcttcaggtgctgtgctcttggctcagtaacagcccaaattatgaggagatcaccaagtggtacctgggttggaagtcgatgttctcagaccaagtgctggcacatccatctgtcaaggacaaatttaatgaggcacttgatatcatgaaccgggcggtgtcctccaacgttggtgcctacatgcagccaggagcacgggagaacattgcctatctcacccacacggagcggaggaaggacttccagtacgaggccatgcaggagaggcgggaggctgagaacatggctcagaggggcattggcgtggccgctagctctgtgcccatgaactttaaggacctcattgagaccaaggctgaggagcacaacattgtcttcatgcccgtcattgggaagcgacacgaagggaagcagctctacacctttggccgcattgtgatctacattgaccggggagtggtctttgtccagggcgagaagacgtgggtgcccacctcactgcagagcctgatcgacatggccaagtga
Sequence Length
2514
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,431 Da
NCBI Official Full Name
Homo sapiens tuftelin interacting protein 11, mRNA
NCBI Official Synonym Full Names
tuftelin interacting protein 11
NCBI Official Symbol
TFIP11
NCBI Official Synonym Symbols
NTR1; TIP39; hNtr1; Spp382; bK445C9.6
NCBI Protein Information
tuftelin-interacting protein 11
UniProt Protein Name
Tuftelin-interacting protein 11
Protein Family
UniProt Gene Name
TFIP11
UniProt Synonym Gene Names
STIP; STIP-1
UniProt Entry Name
TFP11_HUMAN
NCBI Description
TFIP11 is a nuclear speckle-localized protein that may play a role in spliceosome disassembly in Cajal bodies (Stanek et al., 2008 [PubMed 18367544]).[supplied by OMIM, Apr 2009]
Uniprot Description
TFIP11: a protein of unknown function. Contains one G-patch domain which occurs in a number of putative RNA-binding proteins, including tumor suppressor and DNA-damage-repair proteins. May play a role in the secretory pathway of extracellular proteins.
Protein type: RNA-binding; Spliceosome
Chromosomal Location of Human Ortholog: 22q12.1
Cellular Component: nuclear chromosome, telomeric region; nuclear speck; nucleolus; spliceosome
Molecular Function: protein binding
Biological Process: negative regulation of protein binding; negative regulation of protein complex assembly; nuclear mRNA splicing, via spliceosome; protection from non-homologous end joining at telomere; RNA processing; spliceosome disassembly
Research Articles on TFIP11
Similar Products
Product Notes
The TFIP11 tfip11 (Catalog #AAA1271657) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcattgt cccacttata ccgggatggg gaaggccgca ttgatgatga tgatgacgag cgggagaact ttgagatcac tgactgggat ctccagaatg agttcaaccc caaccgacag cgccactggc agaccaagga agaagccacc tacggggtgt gggcagagcg agactcggat gatgagaggc ccagctttgg aggcaaacgg gcccgtgact actctgcgcc agtcaacttc atcagcgcag ggctcaagaa aggggcagcg gaggaggcag agttggaaga ttctgatgac gaagagaaac ctgttaagca ggacgacttt cctaaggatt ttggaccaag gaagctaaaa acgggtggca attttaagcc cagccagaaa ggttttgcag gaggaaccaa atctttcatg gacttcggca gctgggaaag acacacaaaa ggaattggac agaagcttct tcagaagatg ggctacgtcc ctggacgggg cctcgggaag aatgcacaag gtatcattaa cccaattgaa gccaagcaga gaaagggaaa aggtgctgtg ggggcttatg gatccgagcg caccactcag tccatgcaag acttccctgt ggttgactca gaggaagaag ctgaagagga gtttcagaag gagctgagcc agtggaggaa agacccaagt ggaagcaaga agaagcccaa atactcttac aagaccgtgg aagagttgaa ggccaagggc aggattagca agaagctcac tgctccccag aaggaacttt ctcaagtcaa ggtcatagac atgacaggcc gggagcagaa ggtctactac agctacagtc agatcagcca caagcacaac gttcccgatg atgggctgcc gctacagtcc caacagctgc cacagtctgg caaagaggcc aaggcccccg gcttcgcgct gcccgagctg gagcacaacc tgcagctgct catcgacctc acggagcagg agatcatcca gaatgaccgg cagctacagt atgagcggga catggtggtc aacctcttcc acgagctgga gaagatgacc gaggtcctgg accacgagga gcgggtcatc tcgaacctca gcaaggtcct ggagatggtg gaggagtgcg agcggcggat gcagcccgac tgcagcaacc ccctcaccct ggacgagtgt gcccgcatct tcgaaaccct gcaggacaag tactatgagg agtacaggat gtccgaccgt gtggaccttg ctgtggccat cgtctatcca ctcatgaagg agtacttcaa ggagtgggat cccctcaaag actgcactta tggcaccgag atcatctcta agtggaaaag cctcctagag aatgaccagc tcttgtccca tggcggacag gacctctcag cagatgcctt tcacaggttg atatgggaag tctggatgcc ttttgttcga aatattgtca cccagtggca gccaaggaac tgtgacccga tggtggactt tttggatagt tgggtgcaca ttattcctgt gtggatctta gataacatac tggaccaact catcttcccc aagctgcaaa aggaggtgga aaactggaac ccgctcacag acactgttcc catccactct tggatccacc catggctgcc ccttatgcag gcacggctgg agccactcta ttcccccatc cgtagtaagc tgtccagcgc cctgcagaag tggcacccca gcgactcctc tgccaagctc atcctccagc cctggaagga tgtcttcact cctggctcct gggaagcatt catggtcaaa aacatagtgc ccaagctggg gatgtgtctt ggtgagctag tcattaaccc ccaccagcag cacatggatg cattctattg ggtgattgac tgggaaggga tgatctctgt ctctagcctg gtgggacttc ttgaaaagca cttcttcccc aagtggcttc aggtgctgtg ctcttggctc agtaacagcc caaattatga ggagatcacc aagtggtacc tgggttggaa gtcgatgttc tcagaccaag tgctggcaca tccatctgtc aaggacaaat ttaatgaggc acttgatatc atgaaccggg cggtgtcctc caacgttggt gcctacatgc agccaggagc acgggagaac attgcctatc tcacccacac ggagcggagg aaggacttcc agtacgaggc catgcaggag aggcgggagg ctgagaacat ggctcagagg ggcattggcg tggccgctag ctctgtgccc atgaacttta aggacctcat tgagaccaag gctgaggagc acaacattgt cttcatgccc gtcattggga agcgacacga agggaagcag ctctacacct ttggccgcat tgtgatctac attgaccggg gagtggtctt tgtccagggc gagaagacgt gggtgcccac ctcactgcag agcctgatcg acatggccaa gtga. It is sometimes possible for the material contained within the vial of "TFIP11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
