Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TFB1M cdna clone

TFB1M cDNA Clone

Gene Names
TFB1M; CGI75; mtTFB; CGI-75; mtTFB1
Synonyms
TFB1M; TFB1M cDNA Clone; TFB1M cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcctccggaaaactcagcacttgccgtctccctccgttgcccacgattcgagaaatcattaagttgttaagactgcaagcagcgaagcagctatcacagaatttcctcctggacttgaggctgacagataagattgtaaggaaagctggcaatctgacaaatgcttatgtttacgaagtgggccctgggccagggggaatcacaagatctattcttaatgccgacgtcgctgaacttctggtggttgaaaaggacactcgatttattcctggattacagatgctttctgatgcagcacctgggaaactgagaattgttcatggagatgtcttgacatttaaggtagaaaaggctttttcagaaagtcttaaaagaccctgggaagatgatcctccaaatgtacatattattggaaatctgccttttagtgtttcaactccactgattatcaagtggcttgaaaatatttcctgtagagatggaccttttgtttatggcagaactcagatgactttgacttttcaaaaggaagtggcagagagacttgcagccaatacaggaagcaaacagcgtagtcgcctctctgttatggctcagtacctctgcaatgttcgacacatctttacgattccaggacaagcttttgtccccaaaccagaggtggacgtgggcgtggtgcacttcactcccttgatacagcccaagatagagcagccattcaagctggtggaaaaagtggttcagaatgtatttcagttccgaaggaaatactgccatcgagggctcagaatgttattccctgaagcgcagcgcttggaaagcacgggcaggctgttagagttggcagacatagaccctactcttcggccccgccagctctccatctcacactttaagagcctctgtgatgtatacagaaaaatgtgtgatgaagacccacaactctttgcatataatttcagagaagaactcaagcgaagaaaaagcaaaaatgaagaaaaagaagaggatgacgcagagaattacagactctag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,543 Da
NCBI Official Full Name
Homo sapiens transcription factor B1, mitochondrial, mRNA
NCBI Official Synonym Full Names
transcription factor B1, mitochondrial
NCBI Official Symbol
TFB1M
NCBI Official Synonym Symbols
CGI75; mtTFB; CGI-75; mtTFB1
NCBI Protein Information
dimethyladenosine transferase 1, mitochondrial
UniProt Protein Name
Dimethyladenosine transferase 1, mitochondrial
UniProt Gene Name
TFB1M
UniProt Synonym Gene Names
h-mtTFB; h-mtTFB1; hTFB1M; mtTFB1
UniProt Entry Name
TFB1M_HUMAN

NCBI Description

The protein encoded by this gene is a dimethyltransferase that methylates the conserved stem loop of mitochondrial 12S rRNA. The encoded protein also is part of the basal mitochondrial transcription complex and is necessary for mitochondrial gene expression. The methylation and transcriptional activities of this protein are independent of one another. Variations in this gene may influence the severity of aminoglycoside-induced deafness (AID).[provided by RefSeq, Aug 2010]

Uniprot Description

TFB1M: S-adenosyl-L-methionine-dependent methyltransferase which specifically dimethylates mitochondrial 12S rRNA at the conserved stem loop. Also required for basal transcription of mitochondrial DNA, probably via its interaction with POLRMT and TFAM. Stimulates transcription independently of the methyltransferase activity. Variations in TFB1M may influence the clinical expression of aminoglycoside-induced deafness caused by the A1555G mutation in the mitochondrial 12S rRNA. Belongs to the methyltransferase superfamily. rRNA adenine N(6)-methyltransferase family. KsgA subfamily.

Protein type: EC 2.1.1.-; Methyltransferase

Chromosomal Location of Human Ortholog: 6q25.1-q25.3

Cellular Component: mitochondrial matrix

Molecular Function: protein binding; rRNA (adenine-N6,N6-)-dimethyltransferase activity

Biological Process: mitochondrion organization and biogenesis

Research Articles on TFB1M

Similar Products

Product Notes

The TFB1M tfb1m (Catalog #AAA1265878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcct ccggaaaact cagcacttgc cgtctccctc cgttgcccac gattcgagaa atcattaagt tgttaagact gcaagcagcg aagcagctat cacagaattt cctcctggac ttgaggctga cagataagat tgtaaggaaa gctggcaatc tgacaaatgc ttatgtttac gaagtgggcc ctgggccagg gggaatcaca agatctattc ttaatgccga cgtcgctgaa cttctggtgg ttgaaaagga cactcgattt attcctggat tacagatgct ttctgatgca gcacctggga aactgagaat tgttcatgga gatgtcttga catttaaggt agaaaaggct ttttcagaaa gtcttaaaag accctgggaa gatgatcctc caaatgtaca tattattgga aatctgcctt ttagtgtttc aactccactg attatcaagt ggcttgaaaa tatttcctgt agagatggac cttttgttta tggcagaact cagatgactt tgacttttca aaaggaagtg gcagagagac ttgcagccaa tacaggaagc aaacagcgta gtcgcctctc tgttatggct cagtacctct gcaatgttcg acacatcttt acgattccag gacaagcttt tgtccccaaa ccagaggtgg acgtgggcgt ggtgcacttc actcccttga tacagcccaa gatagagcag ccattcaagc tggtggaaaa agtggttcag aatgtatttc agttccgaag gaaatactgc catcgagggc tcagaatgtt attccctgaa gcgcagcgct tggaaagcac gggcaggctg ttagagttgg cagacataga ccctactctt cggccccgcc agctctccat ctcacacttt aagagcctct gtgatgtata cagaaaaatg tgtgatgaag acccacaact ctttgcatat aatttcagag aagaactcaa gcgaagaaaa agcaaaaatg aagaaaaaga agaggatgac gcagagaatt acagactcta g. It is sometimes possible for the material contained within the vial of "TFB1M, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.