Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TEAD3 cdna clone

TEAD3 cDNA Clone

Gene Names
TEAD3; TEF5; TEAD5; TEF-5; DTEF-1; ETFR-1; TEAD-3
Synonyms
TEAD3; TEAD3 cDNA Clone; TEAD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacctggaccaggtctccaaggacaaagcccttcagagcatggcgtccatgtcctctgcccagatcgtctctgccagtgtcctgcagaacaagttcagcccaccttcccctctgccccaggccgtcttctccacttcctcgcggttctggagcagcccccctctcctgggacagcagcctggaccctctcaggacatcaagccctttgcacagccagcctaccccatccagccgcccctgccgccgacgctcagcagttatgagcccctggccccgctcccctcagctgctgcctctgtgcctgtgtggcaggaccgtaccattgcctcctcccggctgcggctcctggagtattcagccttcatggaggtgcagcgagaccctgacacgtacagcaaacacctgtttgtgcacatcggccagacgaaccccgccttctcagacccacccctggaggcagtagatgtgcgccagatctatgacaaattccccgagaaaaagggaggattgaaggagctctatgagaaggggccccctaatgccttcttccttgtcaagttctgggccgacctcaacagcaccatccaggagggcccgggagccttctatggggtcagctctcagtacagctctgctgatagcatgaccatcagcgtctccaccaaggtgtgctcctttggcaaacaggtggtagagaaggtggagactgagtatgccaggctggagaacgggcgctttgtgtaccgtatccaccgctcgcccatgtgcgagtacatgatcaacttcatccacaagctgaagcacctgcccgagaagtacatgatgaacagcgtgctggagaacttcaccatcctgcaggtggtcacgagccgggactcccaggagaccctgcttgtcattgcttttgtcttcgaagtctccaccagtgagcacggggcccagcaccatgtctacaagctcgtcaaagactag
Sequence Length
975
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,676 Da
NCBI Official Full Name
Homo sapiens TEA domain family member 3, mRNA
NCBI Official Synonym Full Names
TEA domain transcription factor 3
NCBI Official Symbol
TEAD3
NCBI Official Synonym Symbols
TEF5; TEAD5; TEF-5; DTEF-1; ETFR-1; TEAD-3
NCBI Protein Information
transcriptional enhancer factor TEF-5
UniProt Protein Name
Transcriptional enhancer factor TEF-5
UniProt Gene Name
TEAD3
UniProt Synonym Gene Names
TEAD5; TEF5; TEAD-3
UniProt Entry Name
TEAD3_HUMAN

NCBI Description

This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and is involved in the transactivation of the chorionic somatomammotropin-B gene enhancer. Translation of this protein is initiated at a non-AUG (AUA) start codon. [provided by RefSeq, Jul 2008]

Uniprot Description

TEAD3: Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds to multiple functional elements of the human chorionic somatomammotropin-B gene enhancer.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 6p21.2

Cellular Component: nucleoplasm

Molecular Function: protein binding; transcription factor activity

Biological Process: asymmetric neuroblast division; female pregnancy; regulation of transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on TEAD3

Similar Products

Product Notes

The TEAD3 tead3 (Catalog #AAA1268945) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacctgg accaggtctc caaggacaaa gcccttcaga gcatggcgtc catgtcctct gcccagatcg tctctgccag tgtcctgcag aacaagttca gcccaccttc ccctctgccc caggccgtct tctccacttc ctcgcggttc tggagcagcc cccctctcct gggacagcag cctggaccct ctcaggacat caagcccttt gcacagccag cctaccccat ccagccgccc ctgccgccga cgctcagcag ttatgagccc ctggccccgc tcccctcagc tgctgcctct gtgcctgtgt ggcaggaccg taccattgcc tcctcccggc tgcggctcct ggagtattca gccttcatgg aggtgcagcg agaccctgac acgtacagca aacacctgtt tgtgcacatc ggccagacga accccgcctt ctcagaccca cccctggagg cagtagatgt gcgccagatc tatgacaaat tccccgagaa aaagggagga ttgaaggagc tctatgagaa ggggccccct aatgccttct tccttgtcaa gttctgggcc gacctcaaca gcaccatcca ggagggcccg ggagccttct atggggtcag ctctcagtac agctctgctg atagcatgac catcagcgtc tccaccaagg tgtgctcctt tggcaaacag gtggtagaga aggtggagac tgagtatgcc aggctggaga acgggcgctt tgtgtaccgt atccaccgct cgcccatgtg cgagtacatg atcaacttca tccacaagct gaagcacctg cccgagaagt acatgatgaa cagcgtgctg gagaacttca ccatcctgca ggtggtcacg agccgggact cccaggagac cctgcttgtc attgcttttg tcttcgaagt ctccaccagt gagcacgggg cccagcacca tgtctacaag ctcgtcaaag actag. It is sometimes possible for the material contained within the vial of "TEAD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.