Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCEAL4 cdna clone

TCEAL4 cDNA Clone

Gene Names
TCEAL4; WEX7; NPD017
Synonyms
TCEAL4; TCEAL4 cDNA Clone; TCEAL4 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaaactctacagtgaaaatgaaggaatggcttcaaaccaaggaaagatggaaaatgaagaacagccacaagacgagagaaagccagaagtaacttgtactctggaagacaagaagttagaaaacgagggaaagacagaaaacaagggcaaaacaggagatgaggaaatgttaaaggataaaggaaagccagagagtgagggagaggcaaaagaaggaaagtcagagagggagggagagtcagagatggagggaggatcagagagagagggaaaaccagagatagagggaaagccagagagtgaaggagagccagggagtgaaacaagggctgcaggaaagcgcccagctgaggatgatgtacccaggaaagccaaaagaaaaactaatacggggctggctcattacctcaaggagtataaagaggctatacatgatatgaatttcagcaatgaggacatgataagagaatttgacaatatggctaaggtgcaggatgagaagagaaaaagcaaacagaaattgggggcgtttttgtggatgcaaagaaatttacaggaccccttctaccctagaggtccaagggaattcaggggtggctgcagggccccacgaagggacattgaagacattccttatgtgtag
Sequence Length
648
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,578 Da
NCBI Official Full Name
Homo sapiens transcription elongation factor A (SII)-like 4, mRNA
NCBI Official Synonym Full Names
transcription elongation factor A like 4
NCBI Official Symbol
TCEAL4
NCBI Official Synonym Symbols
WEX7; NPD017
NCBI Protein Information
transcription elongation factor A protein-like 4
UniProt Protein Name
Transcription elongation factor A protein-like 4
UniProt Gene Name
TCEAL4
UniProt Synonym Gene Names
TCEA-like protein 4
UniProt Entry Name
TCAL4_HUMAN

NCBI Description

This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. This family is comprised of nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternatively splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 13. [provided by RefSeq, Apr 2015]

Uniprot Description

TCEAL4: May be involved in transcriptional regulation. Belongs to the TFS-II family. TFA subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: Xq22.2

Cellular Component: nucleus

Molecular Function: WW domain binding

Biological Process: regulation of transcription from RNA polymerase II promoter

Research Articles on TCEAL4

Similar Products

Product Notes

The TCEAL4 tceal4 (Catalog #AAA1272395) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaac tctacagtga aaatgaagga atggcttcaa accaaggaaa gatggaaaat gaagaacagc cacaagacga gagaaagcca gaagtaactt gtactctgga agacaagaag ttagaaaacg agggaaagac agaaaacaag ggcaaaacag gagatgagga aatgttaaag gataaaggaa agccagagag tgagggagag gcaaaagaag gaaagtcaga gagggaggga gagtcagaga tggagggagg atcagagaga gagggaaaac cagagataga gggaaagcca gagagtgaag gagagccagg gagtgaaaca agggctgcag gaaagcgccc agctgaggat gatgtaccca ggaaagccaa aagaaaaact aatacggggc tggctcatta cctcaaggag tataaagagg ctatacatga tatgaatttc agcaatgagg acatgataag agaatttgac aatatggcta aggtgcagga tgagaagaga aaaagcaaac agaaattggg ggcgtttttg tggatgcaaa gaaatttaca ggaccccttc taccctagag gtccaaggga attcaggggt ggctgcaggg ccccacgaag ggacattgaa gacattcctt atgtgtag. It is sometimes possible for the material contained within the vial of "TCEAL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.