Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBRG4 cdna clone

TBRG4 cDNA Clone

Gene Names
TBRG4; CPR2; FASTKD4
Synonyms
TBRG4; TBRG4 cDNA Clone; TBRG4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagctcacctggtaaagcgatgcacgtgcctcctgagagaagctgctcgtcaggcccctgccatggctccagttggccgactgagacttgcctgggtagcccataagactctgacttcctcagccacctcacccatttcccacctcccaggttccttgatggagccggtggagaaggaacgagcatctactccctacatagagaagcaggtggaccacctcatcaagaaggccacaaggccagaggagctcctggagctacttggtggcagtcacgacttggacagcaatcaagcagcaatggtacttatccggctctctcacttgctgtctgagaagccagaagataaaggcttgctcatacaggatgcccactttcatcaacttctctgtctgctcaacagtcagattgcctcggtctggcatggtaccctctcgaagctgctgggaagcctgtatgctctgggcatccccaaggcctccaaggagctgcagtcggtggagcaggaggtccgctggcgcatgcggaagctcaagtacaagcacctggccttcctggcagagtcctgtgccaccctctcacaggagcagcactcgcaggagctgctggctgagctgctcacacacctggaaaggcgttggacagaaattgaagattcccacacattagtgaccgtcatgatgaaggtgggacacctctcggagccactaatgaaccgcctggaagacaagtgcctggagttggtggagcactttggccccaatgagctgcggaaggtgctggtgatgctggcagctcagagccggcggtccgtgcccttgctgcgggccatctcctaccacctggtgcagaagcccttctctctgacgaaagatgtgctcttggacgtggcctatgcctatggcaaactcagctttcaccagacccaggtgtcccagcgcctggccaccgacctgctatccctcatgcccagcctgacttctggtgaggtggcccactgtgccaagtccttcgccttactcaagtggctcagcctgcccctgtttgaggcctttgcccagcacgtcctgaacagagcgcaggacatcaccctgccccacctgtgcagcgtacttctggcttttgcgcgtctgaacttccatccagaccaagaggatcagttcttcagcctggtacatgagaagctggggtcagagctgccaggcctggagccagccctgcaggtggacctggtgtgggccctgtgtgtgctgcagcaggcacgggaagcagagctgcaagccgtcctccaccctgaatttcacatccaatttctagggggcaagtctcagaaggatcagaacaccttccagaagctgctccacatcaacgccactgccctgctggagtaccccgagtactcgggtccccttctgcctgcctcggctgtggcccctgggccctcagcccttgacaggaaggtgacccccctgcaaaaggagctgcaggagacgctgaaggggctgctggggagcgccgacaagggcagcctcgaggtggccacgcagtatggctgggtgctggatgctgaggtgctgctggacagtgacggcgagtttctgcccgtaagggactttgtggcacctcaccttgcccagccaactgggagccagtcaccacctccagggtctaagaggctagcgttcttgcggtgggagttccccaacttcaacagccgaagcaaggacttgctgggtcgctttgttctggcccggcgacacatagtggctgcaggcttcctgatagtggacgtcccattctatgagtggctggaactcaagtctgaatggcagaaaggcgcctacctcaaggacaagatgcgcaaagcggtggctgaggagctggccaagtga
Sequence Length
1896
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,443 Da
NCBI Official Full Name
Homo sapiens transforming growth factor beta regulator 4, mRNA
NCBI Official Synonym Full Names
transforming growth factor beta regulator 4
NCBI Official Symbol
TBRG4
NCBI Official Synonym Symbols
CPR2; FASTKD4
NCBI Protein Information
protein TBRG4
UniProt Protein Name
Protein TBRG4
Protein Family
UniProt Gene Name
TBRG4
UniProt Synonym Gene Names
CPR2; FASTKD4; KIAA0948; Cell cycle progression protein 2
UniProt Entry Name
TBRG4_HUMAN

Uniprot Description

TBRG4: May play a role in cell cycle progression. Belongs to the FAST kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Mitochondrial; Cell cycle regulation

Chromosomal Location of Human Ortholog: 7p13

Cellular Component: mitochondrion

Molecular Function: protein binding

Biological Process: cell cycle arrest; cellular respiration; positive regulation of cell proliferation

Research Articles on TBRG4

Similar Products

Product Notes

The TBRG4 tbrg4 (Catalog #AAA1268510) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctc acctggtaaa gcgatgcacg tgcctcctga gagaagctgc tcgtcaggcc cctgccatgg ctccagttgg ccgactgaga cttgcctggg tagcccataa gactctgact tcctcagcca cctcacccat ttcccacctc ccaggttcct tgatggagcc ggtggagaag gaacgagcat ctactcccta catagagaag caggtggacc acctcatcaa gaaggccaca aggccagagg agctcctgga gctacttggt ggcagtcacg acttggacag caatcaagca gcaatggtac ttatccggct ctctcacttg ctgtctgaga agccagaaga taaaggcttg ctcatacagg atgcccactt tcatcaactt ctctgtctgc tcaacagtca gattgcctcg gtctggcatg gtaccctctc gaagctgctg ggaagcctgt atgctctggg catccccaag gcctccaagg agctgcagtc ggtggagcag gaggtccgct ggcgcatgcg gaagctcaag tacaagcacc tggccttcct ggcagagtcc tgtgccaccc tctcacagga gcagcactcg caggagctgc tggctgagct gctcacacac ctggaaaggc gttggacaga aattgaagat tcccacacat tagtgaccgt catgatgaag gtgggacacc tctcggagcc actaatgaac cgcctggaag acaagtgcct ggagttggtg gagcactttg gccccaatga gctgcggaag gtgctggtga tgctggcagc tcagagccgg cggtccgtgc ccttgctgcg ggccatctcc taccacctgg tgcagaagcc cttctctctg acgaaagatg tgctcttgga cgtggcctat gcctatggca aactcagctt tcaccagacc caggtgtccc agcgcctggc caccgacctg ctatccctca tgcccagcct gacttctggt gaggtggccc actgtgccaa gtccttcgcc ttactcaagt ggctcagcct gcccctgttt gaggcctttg cccagcacgt cctgaacaga gcgcaggaca tcaccctgcc ccacctgtgc agcgtacttc tggcttttgc gcgtctgaac ttccatccag accaagagga tcagttcttc agcctggtac atgagaagct ggggtcagag ctgccaggcc tggagccagc cctgcaggtg gacctggtgt gggccctgtg tgtgctgcag caggcacggg aagcagagct gcaagccgtc ctccaccctg aatttcacat ccaatttcta gggggcaagt ctcagaagga tcagaacacc ttccagaagc tgctccacat caacgccact gccctgctgg agtaccccga gtactcgggt ccccttctgc ctgcctcggc tgtggcccct gggccctcag cccttgacag gaaggtgacc cccctgcaaa aggagctgca ggagacgctg aaggggctgc tggggagcgc cgacaagggc agcctcgagg tggccacgca gtatggctgg gtgctggatg ctgaggtgct gctggacagt gacggcgagt ttctgcccgt aagggacttt gtggcacctc accttgccca gccaactggg agccagtcac cacctccagg gtctaagagg ctagcgttct tgcggtggga gttccccaac ttcaacagcc gaagcaagga cttgctgggt cgctttgttc tggcccggcg acacatagtg gctgcaggct tcctgatagt ggacgtccca ttctatgagt ggctggaact caagtctgaa tggcagaaag gcgcctacct caaggacaag atgcgcaaag cggtggctga ggagctggcc aagtga. It is sometimes possible for the material contained within the vial of "TBRG4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.