TBL3 cdna clone
TBL3 cDNA Clone
Gene Names
TBL3; SAZD; UTP13
Synonyms
TBL3; TBL3 cDNA Clone; TBL3 cdna clone
Sequence
atggcagagaccgcggccggagtgggccgcttcaagaccaactatgctgtggagcgcaaaattgagcctttctacaagggcggaaaagcacagctggaccagactggccagcacctcttctgcgtctgtggcaccagagtcaacattctggaagtggcctcgggggccgtgctgcggagtctggagcaggaggaccaggaggacatcactgcctttgacctcagccctgacaacgaggtgctggtgacagccagtcgggcattgctgctggctcagtgggcctggcaagagggcagcgttacccgcctgtggaaggcgatacacacggcccccgtggccaccatggccttcgaccccacctccactctgctagccacaggtggctgtgatggggccgtgcgcgtctgggacatcgtgcggcactacgggacacaccacttccgaggctcgcccggtgtcgtgcacctagtggccttccacccggaccctacacgcctgctgctcttctcctcggccacggatgccgccatccgcgtgtggtcactgcaggaccggtcatgcctggctgtgctgactgcccactacagcgccgtcacctcactggccttcagcgccgacggccacaccatgctcagctccggccgtgacaagatatgtatcatctgggaccttcagagctgccaggccacgaggaccgtgcctgtgtttgagagcgtggaggctgctgtgctgttgccagaggagccagtgtcccagctgggtgtgaagtccccagggctgtactttctgacagctggcgaccaaggcactctgcgcgtgtgggaggcagcttctgggcagtgtgtgtacacgcaggcccagccgccgggccctgggcaggagctgacccactgcaccctggcacacaccgccggcgtggtcctcaccgccaccgccgaccacaacctgttgctctacgaggctcgctccctgcggctgcagaaacagttcgctggctacagtgaggaggttttggatgtccggtttcttgggcccgaggactcccacgttgtcgtggcctccaatagcccctgcctaaaagtgtttgagctgcagacgtcagcctgccagatcctccacggccacacggatatcgtcctggccctggatgtgttccggaaggggtggctctttgccagctgtgccaaggatcagagcgtccgtatctggagaatgaacaaggctggccaggtgatgtgcgtggctcagggttccggtcacacacacagtgtgggcaccgtctgctgctctaggctgaaggagtccttcctggtgacaggcagccaggactgcactgtgaagctgtggcctcttcccaaagccttgctgtccaagaacacagccccagacaacggccctatcctcctgcaggcccagaccactcagcgctgccatgataaggacatcaacagcgtggctattgcccccaacgacaagctgctggccacaggctcacaggaccgcacggccaagctctgggccctgccacagtgccagctgctgggtgtcttctcaggccaccggcgtggcctctggtgcgtccagttctctcccatggaccaggtgctggccacggcctcagctgatggcaccatcaagctctgggcactccaggacttcagctgtctcaagacatttgaggggcacgatgcttctgtgctgaaggtggcctttgtgagccgtggcacgcagctgctgtccagcggttcggatggcctcgtgaagctctggaccatcaagaacaacgagtgtgtgcggacgctggatgcccacgaggacaaggtctgggggctgcactgcagccggctggacgaccacgccctcactggggccagtgactcccgagtcatcctctggaaggatgtgaccgaggcggagcaggcagaggagcaggccaggcaagaggagcaggtggtcaggcagcaagagctggacaacctgctgcatgagaagcggtacctgcgggcgctgggcctggccatctccctggatcggccccacaccgtgctgactgtcatccaggccatccggagggaccctgaggcctgcgagaagctggaagccaccatgctccgactgcggcgcgaccagaaagaggccctgctgcgcttctgcgtcacgtggaacaccaactcgcggcactgccacgaggcccaggccgtgctgggtgtgctcttgaggcgagaggcccccgaggagctgctggcctacgaaggcgtgcgggcagcgcttgaggccctgctgccctacactgagcggcactttcagcggctcagcaggaccctccaggccgccgctttcttggacttcctgtggcacaacatgaagctccctgtgccggccgccgcccccaccccctgggaaacccataaaggcgcactgccct
Sequence Length
2425
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
89,035 Da
NCBI Official Full Name
Homo sapiens transducin (beta)-like 3, mRNA
NCBI Official Synonym Full Names
transducin beta like 3
NCBI Official Symbol
TBL3
NCBI Official Synonym Symbols
SAZD; UTP13
NCBI Protein Information
transducin beta-like protein 3
UniProt Protein Name
Transducin beta-like protein 3
Protein Family
UniProt Gene Name
TBL3
UniProt Synonym Gene Names
SAZD
UniProt Entry Name
TBL3_HUMAN
NCBI Description
The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Uniprot Description
TBL3:
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 16p13.3
Cellular Component: nucleolus; nucleoplasm; nucleus; small subunit processome
Molecular Function: protein binding; snoRNA binding
Biological Process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); rRNA processing
Research Articles on TBL3
Similar Products
Product Notes
The TBL3 tbl3 (Catalog #AAA1272693) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga ccgcggccgg agtgggccgc ttcaagacca actatgctgt ggagcgcaaa attgagcctt tctacaaggg cggaaaagca cagctggacc agactggcca gcacctcttc tgcgtctgtg gcaccagagt caacattctg gaagtggcct cgggggccgt gctgcggagt ctggagcagg aggaccagga ggacatcact gcctttgacc tcagccctga caacgaggtg ctggtgacag ccagtcgggc attgctgctg gctcagtggg cctggcaaga gggcagcgtt acccgcctgt ggaaggcgat acacacggcc cccgtggcca ccatggcctt cgaccccacc tccactctgc tagccacagg tggctgtgat ggggccgtgc gcgtctggga catcgtgcgg cactacggga cacaccactt ccgaggctcg cccggtgtcg tgcacctagt ggccttccac ccggacccta cacgcctgct gctcttctcc tcggccacgg atgccgccat ccgcgtgtgg tcactgcagg accggtcatg cctggctgtg ctgactgccc actacagcgc cgtcacctca ctggccttca gcgccgacgg ccacaccatg ctcagctccg gccgtgacaa gatatgtatc atctgggacc ttcagagctg ccaggccacg aggaccgtgc ctgtgtttga gagcgtggag gctgctgtgc tgttgccaga ggagccagtg tcccagctgg gtgtgaagtc cccagggctg tactttctga cagctggcga ccaaggcact ctgcgcgtgt gggaggcagc ttctgggcag tgtgtgtaca cgcaggccca gccgccgggc cctgggcagg agctgaccca ctgcaccctg gcacacaccg ccggcgtggt cctcaccgcc accgccgacc acaacctgtt gctctacgag gctcgctccc tgcggctgca gaaacagttc gctggctaca gtgaggaggt tttggatgtc cggtttcttg ggcccgagga ctcccacgtt gtcgtggcct ccaatagccc ctgcctaaaa gtgtttgagc tgcagacgtc agcctgccag atcctccacg gccacacgga tatcgtcctg gccctggatg tgttccggaa ggggtggctc tttgccagct gtgccaagga tcagagcgtc cgtatctgga gaatgaacaa ggctggccag gtgatgtgcg tggctcaggg ttccggtcac acacacagtg tgggcaccgt ctgctgctct aggctgaagg agtccttcct ggtgacaggc agccaggact gcactgtgaa gctgtggcct cttcccaaag ccttgctgtc caagaacaca gccccagaca acggccctat cctcctgcag gcccagacca ctcagcgctg ccatgataag gacatcaaca gcgtggctat tgcccccaac gacaagctgc tggccacagg ctcacaggac cgcacggcca agctctgggc cctgccacag tgccagctgc tgggtgtctt ctcaggccac cggcgtggcc tctggtgcgt ccagttctct cccatggacc aggtgctggc cacggcctca gctgatggca ccatcaagct ctgggcactc caggacttca gctgtctcaa gacatttgag gggcacgatg cttctgtgct gaaggtggcc tttgtgagcc gtggcacgca gctgctgtcc agcggttcgg atggcctcgt gaagctctgg accatcaaga acaacgagtg tgtgcggacg ctggatgccc acgaggacaa ggtctggggg ctgcactgca gccggctgga cgaccacgcc ctcactgggg ccagtgactc ccgagtcatc ctctggaagg atgtgaccga ggcggagcag gcagaggagc aggccaggca agaggagcag gtggtcaggc agcaagagct ggacaacctg ctgcatgaga agcggtacct gcgggcgctg ggcctggcca tctccctgga tcggccccac accgtgctga ctgtcatcca ggccatccgg agggaccctg aggcctgcga gaagctggaa gccaccatgc tccgactgcg gcgcgaccag aaagaggccc tgctgcgctt ctgcgtcacg tggaacacca actcgcggca ctgccacgag gcccaggccg tgctgggtgt gctcttgagg cgagaggccc ccgaggagct gctggcctac gaaggcgtgc gggcagcgct tgaggccctg ctgccctaca ctgagcggca ctttcagcgg ctcagcagga ccctccaggc cgccgctttc ttggacttcc tgtggcacaa catgaagctc cctgtgccgg ccgccgcccc caccccctgg gaaacccata aaggcgcact gccct. It is sometimes possible for the material contained within the vial of "TBL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
