Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBL1X cdna clone

TBL1X cDNA Clone

Gene Names
TBL1X; EBI; TBL1; SMAP55
Synonyms
TBL1X; TBL1X cDNA Clone; TBL1X cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgagctcgctggcgcctcttcatcgtgctgccaccgccctgcaggaagaggggccatgcagtcagtcttgcaccactttcaacgtttgcgagggagagagggtggttcccacttcatcaacacctcatcgccgcgaggtgaggctaagatgagcataaccagtgacgaggtgaactttctggtgtatcggtatctccaggagtcaggtttttcccactcggctttcacgtttgggattgagagccacatcagccagtccaacatcaatgggacgctagtgccaccggccgccctcatctccattctccagaagggcctgcagtatgtagaggccgagatcagtatcaacgaggatggcacagtgttcgacggccgccccatagagtccctgtcactgatagacgccgtgatgcccgacgtggtgcagacgcggcagcaggcattccgagagaagctcgctcagcagcaagccagtgcggcggcggcggcggctgcggccacggcagcagcgacagcagccaccacgacctcagccggcgtttcccaccaaaatccatcgaagaacagagaggccacggtgaatggggaagagaacagagcacattcagtcaataatcacgcgaagccaatggaaatagatggagaggttgagattccatccagcaaagccacagtccttcggggccatgagtctgaggtgttcatttgtgcctggaatcctgtcagtgatttgctagcctccggatctggagactcaactgcaaggatatggaacctgaatgagaatagcaacgggggctccacccagctcgtgttgaggcactgtatacgagaggggggccatgacgtcccgagtaacaaagacgtcacctcactggactggaataccaatggaacactcttggctacgggttcatatgacggttttgcaagaatatggacggaagatggtaacctggccagcaccttaggccaacataaaggccccatctttgccttgaaatggaaccgaaaggggaattacattttgagtgctggtgtagacaaaacaacaataatttgggatgcccacacaggagaagccaaacagcagtttccttttcattcagcccctgcccttgatgtggactggcagaacaacacgacctttgcctcctgtagcacagacatgtgtatccatgtgtgcaggctcggctgtgaccgcccagtcaaaaccttccagggacacacaaacgaggtcaacgccatcaaatgggatccgtctggaatgttgctggcatcctgctcggatgacatgacattgaagatctggagcatgaaacaggaggtgtgcatccatgatcttcaggctcacaataaagagatctacaccatcaagtggagccccactgggcccgccaccagcaacccaaactccaacatcatgttggcaagtgcttcgtttgattctacggtgcgactgtgggacatagaacgaggcgtctgcacccacacgctcacgaagcatcaggagcctgtctatagcgtagctttcagccctgatgggaagtacttggccagtggatccttcgacaagtgcgtccatatctggaatactcagagtggaaatcttgtccacagctaccgaggcactggcggcatcttcgaggtgtgctggaacgcccgaggagacaaagtgggtgccagcgcgtccgacggctctgtgtgtgttttggatctgcggaagtaa
Sequence Length
1734
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,049 Da
NCBI Official Full Name
Homo sapiens transducin (beta)-like 1X-linked, mRNA
NCBI Official Synonym Full Names
transducin beta like 1X-linked
NCBI Official Symbol
TBL1X
NCBI Official Synonym Symbols
EBI; TBL1; SMAP55
NCBI Protein Information
F-box-like/WD repeat-containing protein TBL1X
UniProt Protein Name
F-box-like/WD repeat-containing protein TBL1X
UniProt Gene Name
TBL1X
UniProt Synonym Gene Names
TBL1
UniProt Entry Name
TBL1X_HUMAN

NCBI Description

The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This encoded protein is found as a subunit in corepressor SMRT (silencing mediator for retinoid and thyroid receptors) complex along with histone deacetylase 3 protein. This gene is located adjacent to the ocular albinism gene and it is thought to be involved in the pathogenesis of the ocular albinism with late-onset sensorineural deafness phenotype. Four transcript variants encoding two different isoforms have been found for this gene. This gene is highly similar to the Y chromosome TBL1Y gene. [provided by RefSeq, Nov 2008]

Uniprot Description

TBL1X: F-box-like protein involved in the recruitment of the ubiquitin/19S proteasome complex to nuclear receptor-regulated transcription units. Plays an essential role in transcription activation mediated by nuclear receptors. Probably acts as integral component of corepressor complexes that mediates the recruitment of the 19S proteasome complex, leading to the subsequent proteasomal degradation of transcription repressor complexes, thereby allowing cofactor exchange. Belongs to the WD repeat EBI family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: Xp22.3

Cellular Component: histone deacetylase complex; nucleoplasm; nucleus; spindle microtubule; transcriptional repressor complex

Molecular Function: beta-catenin binding; histone binding; protein binding; protein C-terminus binding; protein domain specific binding; transcription corepressor activity; transcription factor binding

Biological Process: cellular lipid metabolic process; histone deacetylation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; proteolysis; sensory perception of sound; Wnt receptor signaling pathway through beta-catenin

Research Articles on TBL1X

Similar Products

Product Notes

The TBL1X tbl1x (Catalog #AAA1278629) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgagc tcgctggcgc ctcttcatcg tgctgccacc gccctgcagg aagaggggcc atgcagtcag tcttgcacca ctttcaacgt ttgcgaggga gagagggtgg ttcccacttc atcaacacct catcgccgcg aggtgaggct aagatgagca taaccagtga cgaggtgaac tttctggtgt atcggtatct ccaggagtca ggtttttccc actcggcttt cacgtttggg attgagagcc acatcagcca gtccaacatc aatgggacgc tagtgccacc ggccgccctc atctccattc tccagaaggg cctgcagtat gtagaggccg agatcagtat caacgaggat ggcacagtgt tcgacggccg ccccatagag tccctgtcac tgatagacgc cgtgatgccc gacgtggtgc agacgcggca gcaggcattc cgagagaagc tcgctcagca gcaagccagt gcggcggcgg cggcggctgc ggccacggca gcagcgacag cagccaccac gacctcagcc ggcgtttccc accaaaatcc atcgaagaac agagaggcca cggtgaatgg ggaagagaac agagcacatt cagtcaataa tcacgcgaag ccaatggaaa tagatggaga ggttgagatt ccatccagca aagccacagt ccttcggggc catgagtctg aggtgttcat ttgtgcctgg aatcctgtca gtgatttgct agcctccgga tctggagact caactgcaag gatatggaac ctgaatgaga atagcaacgg gggctccacc cagctcgtgt tgaggcactg tatacgagag gggggccatg acgtcccgag taacaaagac gtcacctcac tggactggaa taccaatgga acactcttgg ctacgggttc atatgacggt tttgcaagaa tatggacgga agatggtaac ctggccagca ccttaggcca acataaaggc cccatctttg ccttgaaatg gaaccgaaag gggaattaca ttttgagtgc tggtgtagac aaaacaacaa taatttggga tgcccacaca ggagaagcca aacagcagtt tccttttcat tcagcccctg cccttgatgt ggactggcag aacaacacga cctttgcctc ctgtagcaca gacatgtgta tccatgtgtg caggctcggc tgtgaccgcc cagtcaaaac cttccaggga cacacaaacg aggtcaacgc catcaaatgg gatccgtctg gaatgttgct ggcatcctgc tcggatgaca tgacattgaa gatctggagc atgaaacagg aggtgtgcat ccatgatctt caggctcaca ataaagagat ctacaccatc aagtggagcc ccactgggcc cgccaccagc aacccaaact ccaacatcat gttggcaagt gcttcgtttg attctacggt gcgactgtgg gacatagaac gaggcgtctg cacccacacg ctcacgaagc atcaggagcc tgtctatagc gtagctttca gccctgatgg gaagtacttg gccagtggat ccttcgacaa gtgcgtccat atctggaata ctcagagtgg aaatcttgtc cacagctacc gaggcactgg cggcatcttc gaggtgtgct ggaacgcccg aggagacaaa gtgggtgcca gcgcgtccga cggctctgtg tgtgttttgg atctgcggaa gtaa. It is sometimes possible for the material contained within the vial of "TBL1X, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.