Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

TBCD cdna clone

TBCD cDNA Clone

Gene Names
TBCD; tfcD; SSD-1
Synonyms
TBCD; TBCD cDNA Clone; TBCD cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgaagatcagccactgggatggggtcatccgagagttggctgcgagggcgctgcacaacctggcccagcaggcacccgagttcagcgccacgcaagtcttcccgaggctgctgtccatgacactgagtccagatcttcacacgaggcatgggtcgattctcgcctgcgcagaagttgcttacgccttgtacaaacttgcagcccaagagaacaggcccgtcacggaccatctggacgagcaggcagtgcagggcctgaagcagattcaccagcagctctatgatcgtcagttatacaggggtctgggaggacagctcatgagacaagcagtgtgtgttttaatagaaaagttgtcactttccaaaatgccctttagaggtgacaccgtaattgatggttggcaatggctgataaatgacactttgagacatctccatctcatctcaagtcactcccgccagcagatgaaggatgcagcagtctcggccctggctgctctatgcagtgaatattacatgaaggagccgggggaggcagatcccgcaattcaggaggagctgatcacgcagtacctggctgagcttcggaaccccgaggagatgactcgctgtggcttctcgttggccttgggcgcccttccaggcttccttctgaaaggccggctccagcaggttctcacaggtttaagagcagttacccacacttcccccgaggacgtaagttttgctgagtccaggagagacggcttgaaggccattgcgaggatttgccagactgttggtgtgaaagcaggagccccagacgaagctgtgtgcggagagaatgtttcccagatttactgtgcgctgctgggctgcatggacgactacaccacggacagcagaggggacgtgggcacctgggtccgcaaggccgccatgaccagtctgatggatctgacacttctgctggctcggagccagcctgagctgatcgaggcccatacctgtgagcgcatcatgtgctgtgtggcccagcaggccagtgagaagattgaccgtttccgtgctcacgccgccagcgtgttcctgacgctcctgcactttgacagccctcccatcccccacgtgccccaccgaggagaactggaaaagctgtttcccaggtccgacgtggcctccgtgaactggagtgcaccttcccaggccttcccacgcatcacccagctccttgggctgcccacctaccgctaccacgtcctgctggggctagtcgtgtccctgggcggcttgacggagtcgacgatccggcactccacccagagcctctttgagtacatgaagggcattcagagcgacccgcaggccctgggcagcttcagcgggacccttctgcagatctttgaggacaaccttctgaatgagagggtgtccgtgccgctgctgaagacgctggaccacgtgctcacccacggctgcttcgacatcttcaccacggaggaggaccacccctttgctgtgaagttgcttgcgctctgtaagaaagaaatcaagaattcaaaagatatccagaagctcctgtcaggcatcgcagtgttctgcgggatggtgcagttccccggcgacgtgaggaggcaggccctcctgcagctgtgtctgctcctctgccaccgtttcccgctgatccggaagaccacggccagccaggtgtacgagacattgctcacctacagtgacgtcgtgggcgcggatgtgctggacgaggtggtgactgtgctcagtgacactgcgtgggacgcggagcttgcagtggtgagagagcagcgcaaccgtctgtgtgaccttctgggcgtacccaggccccagctggtgccccagcctggtgcctgctga
Sequence Length
1872
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,263 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor D, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor D
NCBI Official Symbol
TBCD
NCBI Official Synonym Symbols
tfcD; SSD-1
NCBI Protein Information
tubulin-specific chaperone D
UniProt Protein Name
Tubulin-specific chaperone D
UniProt Gene Name
TBCD
UniProt Synonym Gene Names
KIAA0988; SSD1; TFCD; tfcD
UniProt Entry Name
TBCD_HUMAN

NCBI Description

Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Uniprot Description

TBCD: Tubulin-folding protein; involved in the first step of the tubulin folding pathway. Modulates microtubule dynamics by capturing GTP-bound beta-tubulin (TUBB). Acts as a GTPase- activating protein (GAP) for ARL2. Its ability to interact with beta tubulin is regulated via its interaction with ARL2. Induces microtubule disruption in absence of ARL2. Increases degradation of beta tubulin, when overexpressed in polarized cells. Promotes epithelial cell detachment, a process antagonized by ARL2. Induces tight adherens and tight junctions disassembly at the lateral cell membrane. Belongs to the TBCD family. 5 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: adherens junction; lateral plasma membrane; microtubule; tight junction

Molecular Function: beta-tubulin binding; chaperone binding; GTPase activator activity; protein binding

Biological Process: negative regulation of microtubule polymerization; post-chaperonin tubulin folding pathway; protein folding; tubulin folding

Research Articles on TBCD

Similar Products

Product Notes

The TBCD tbcd (Catalog #AAA1278497) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatca gccactggga tggggtcatc cgagagttgg ctgcgagggc gctgcacaac ctggcccagc aggcacccga gttcagcgcc acgcaagtct tcccgaggct gctgtccatg acactgagtc cagatcttca cacgaggcat gggtcgattc tcgcctgcgc agaagttgct tacgccttgt acaaacttgc agcccaagag aacaggcccg tcacggacca tctggacgag caggcagtgc agggcctgaa gcagattcac cagcagctct atgatcgtca gttatacagg ggtctgggag gacagctcat gagacaagca gtgtgtgttt taatagaaaa gttgtcactt tccaaaatgc cctttagagg tgacaccgta attgatggtt ggcaatggct gataaatgac actttgagac atctccatct catctcaagt cactcccgcc agcagatgaa ggatgcagca gtctcggccc tggctgctct atgcagtgaa tattacatga aggagccggg ggaggcagat cccgcaattc aggaggagct gatcacgcag tacctggctg agcttcggaa ccccgaggag atgactcgct gtggcttctc gttggccttg ggcgcccttc caggcttcct tctgaaaggc cggctccagc aggttctcac aggtttaaga gcagttaccc acacttcccc cgaggacgta agttttgctg agtccaggag agacggcttg aaggccattg cgaggatttg ccagactgtt ggtgtgaaag caggagcccc agacgaagct gtgtgcggag agaatgtttc ccagatttac tgtgcgctgc tgggctgcat ggacgactac accacggaca gcagagggga cgtgggcacc tgggtccgca aggccgccat gaccagtctg atggatctga cacttctgct ggctcggagc cagcctgagc tgatcgaggc ccatacctgt gagcgcatca tgtgctgtgt ggcccagcag gccagtgaga agattgaccg tttccgtgct cacgccgcca gcgtgttcct gacgctcctg cactttgaca gccctcccat cccccacgtg ccccaccgag gagaactgga aaagctgttt cccaggtccg acgtggcctc cgtgaactgg agtgcacctt cccaggcctt cccacgcatc acccagctcc ttgggctgcc cacctaccgc taccacgtcc tgctggggct agtcgtgtcc ctgggcggct tgacggagtc gacgatccgg cactccaccc agagcctctt tgagtacatg aagggcattc agagcgaccc gcaggccctg ggcagcttca gcgggaccct tctgcagatc tttgaggaca accttctgaa tgagagggtg tccgtgccgc tgctgaagac gctggaccac gtgctcaccc acggctgctt cgacatcttc accacggagg aggaccaccc ctttgctgtg aagttgcttg cgctctgtaa gaaagaaatc aagaattcaa aagatatcca gaagctcctg tcaggcatcg cagtgttctg cgggatggtg cagttccccg gcgacgtgag gaggcaggcc ctcctgcagc tgtgtctgct cctctgccac cgtttcccgc tgatccggaa gaccacggcc agccaggtgt acgagacatt gctcacctac agtgacgtcg tgggcgcgga tgtgctggac gaggtggtga ctgtgctcag tgacactgcg tgggacgcgg agcttgcagt ggtgagagag cagcgcaacc gtctgtgtga ccttctgggc gtacccaggc cccagctggt gccccagcct ggtgcctgct ga. It is sometimes possible for the material contained within the vial of "TBCD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual