Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBCC cdna clone

TBCC cDNA Clone

Gene Names
TBCC; CFC
Synonyms
TBCC; TBCC cDNA Clone; TBCC cdna clone
Ordering
For Research Use Only!
Sequence
atggagtccgtcagttgctccgctgctgctgtcaggaccggagacatggagtcccagcgggacctgagcctggtgcctgagcggcttcagagacgcgaacaagaacggcagctggaagttgaaaggcggaaacaaaagcggcagaaccaggaggtagagaaggagaacagccactttttcgtcgccacctttgctcgggagcgagcggccgtggaagagcttctggagcgcgcggagtcggtcgagcggctggaggaggcggcctctcggctccaggggctgcagaaactaatcaacgactcagtttttttcctagccgcttacgacctgcggcagggacaagaggcgctggcgcggctgcaggcggccttggccgagcggcgccgggggctgcagcccaagaagcgtttcgctttcaagacccggggaaaggatgctgcttcgtctaccaaagtagacgcggctcctggcatccccccggcagttgaaagcatacaggactccccgctgcccaagaaggcggaaggagacctcggccccagctgggtctgcggtttctccaacctggagtcccaagtcttggagaagagagccagcgagttgcaccagcgcgacgttcttttgaccgaactgagcaactgcacggtcagactttatggaaatcccaacaccctgcggctaaccaaggcccacagctgcaagctgctctgcggtccggtgtctacctctgttttcctggaggactgcagtgactgcgtgctggcagtggcctgccaacagctccgcatacacagtacgaaagacacccgcatcttcctgcaggtgaccagcagggccatcgtggaggactgcagtgggatccagttcgccccttacacctggagctacccggagatcgacaaggacttcgagagctctggtttagataggagcaaaaataactggaacgatgttgacgattttaactggctggcccgggatatggcctccccaaactggagtattcttcctgaagaggagcgaaatatccagtgggactaa
Sequence Length
1041
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,248 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor C, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor C
NCBI Official Symbol
TBCC
NCBI Official Synonym Symbols
CFC
NCBI Protein Information
tubulin-specific chaperone C
UniProt Protein Name
Tubulin-specific chaperone C
UniProt Gene Name
TBCC
UniProt Synonym Gene Names
CFC
UniProt Entry Name
TBCC_HUMAN

NCBI Description

Cofactor C is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Uniprot Description

TBCC: Tubulin-folding protein; involved in the final step of the tubulin folding pathway. Belongs to the TBCC family.

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: cytoplasm; cytoskeleton; microtubule; photoreceptor connecting cilium

Molecular Function: chaperone binding; GTPase activity

Biological Process: post-chaperonin tubulin folding pathway; protein folding; tubulin folding

Research Articles on TBCC

Similar Products

Product Notes

The TBCC tbcc (Catalog #AAA1266832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtccg tcagttgctc cgctgctgct gtcaggaccg gagacatgga gtcccagcgg gacctgagcc tggtgcctga gcggcttcag agacgcgaac aagaacggca gctggaagtt gaaaggcgga aacaaaagcg gcagaaccag gaggtagaga aggagaacag ccactttttc gtcgccacct ttgctcggga gcgagcggcc gtggaagagc ttctggagcg cgcggagtcg gtcgagcggc tggaggaggc ggcctctcgg ctccaggggc tgcagaaact aatcaacgac tcagtttttt tcctagccgc ttacgacctg cggcagggac aagaggcgct ggcgcggctg caggcggcct tggccgagcg gcgccggggg ctgcagccca agaagcgttt cgctttcaag acccggggaa aggatgctgc ttcgtctacc aaagtagacg cggctcctgg catccccccg gcagttgaaa gcatacagga ctccccgctg cccaagaagg cggaaggaga cctcggcccc agctgggtct gcggtttctc caacctggag tcccaagtct tggagaagag agccagcgag ttgcaccagc gcgacgttct tttgaccgaa ctgagcaact gcacggtcag actttatgga aatcccaaca ccctgcggct aaccaaggcc cacagctgca agctgctctg cggtccggtg tctacctctg ttttcctgga ggactgcagt gactgcgtgc tggcagtggc ctgccaacag ctccgcatac acagtacgaa agacacccgc atcttcctgc aggtgaccag cagggccatc gtggaggact gcagtgggat ccagttcgcc ccttacacct ggagctaccc ggagatcgac aaggacttcg agagctctgg tttagatagg agcaaaaata actggaacga tgttgacgat tttaactggc tggcccggga tatggcctcc ccaaactgga gtattcttcc tgaagaggag cgaaatatcc agtgggacta a. It is sometimes possible for the material contained within the vial of "TBCC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.