Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBCA cdna clone

TBCA cDNA Clone

Synonyms
TBCA; TBCA cDNA Clone; TBCA cdna clone
Ordering
For Research Use Only!
Sequence
atggccgatcctcgcgtgagacagatcaagatcaagaccggcgtggtgaagcggttggtcaaagaaaaagtgatgtatgaaaaagaggcaaaacaacaagaagaaaagattgaaaaaatgagagctgaagacggtgaaaattatgacattaaaaagcaggcagagatcctacaagaatccaggatgatgatcccagattgccagcgcaggttggaagccgcatatttggatcttcaacggatactagaaaatgaaaaagacttggaagaagctgaggaatataaagaagcacgtttagtactggattcagtgaagttagaagcctga
Sequence Length
327
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,792 Da
NCBI Official Full Name
Homo sapiens tubulin folding cofactor A, mRNA
NCBI Official Synonym Full Names
tubulin folding cofactor A
NCBI Official Symbol
TBCA
NCBI Protein Information
tubulin-specific chaperone A
UniProt Protein Name
Tubulin-specific chaperone A
UniProt Gene Name
TBCA
UniProt Synonym Gene Names
CFA
UniProt Entry Name
TBCA_HUMAN

NCBI Description

The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

TBCA: Tubulin-folding protein; involved in the early step of the tubulin folding pathway. Belongs to the TBCA family.

Protein type: Cytoskeletal; Chaperone

Chromosomal Location of Human Ortholog: 5q14.1

Cellular Component: cytoplasm; microtubule cytoskeleton; nucleolus

Molecular Function: chaperone binding; protein binding

Biological Process: protein folding

Research Articles on TBCA

Similar Products

Product Notes

The TBCA tbca (Catalog #AAA1273360) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgatc ctcgcgtgag acagatcaag atcaagaccg gcgtggtgaa gcggttggtc aaagaaaaag tgatgtatga aaaagaggca aaacaacaag aagaaaagat tgaaaaaatg agagctgaag acggtgaaaa ttatgacatt aaaaagcagg cagagatcct acaagaatcc aggatgatga tcccagattg ccagcgcagg ttggaagccg catatttgga tcttcaacgg atactagaaa atgaaaaaga cttggaagaa gctgaggaat ataaagaagc acgtttagta ctggattcag tgaagttaga agcctga. It is sometimes possible for the material contained within the vial of "TBCA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.