Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAT cdna clone

TAT cDNA Clone

Synonyms
TAT; TAT cDNA Clone; TAT cdna clone
Ordering
For Research Use Only!
Sequence
atggacccatacatgattcagatgagcagcaaaggcaacctctcctcaattctggacgtgcatgtcaacgttggtgggagaagctctgtgccgggaaaaatgaaaggcagaaaggccaggtggtctgtgaggccctcagacatggccaagaaaactttcaaccccatccgagccattgtggacaacatgaaggtgaaaccaaatccaaacaaaaccatgatttccctgtccattggggaccctactgtgtttggaaacctgcctacagaccctgaagttacccaggcaatgaaagatgccctggactcgggcaaatataatggctatgccccatccatcggcttcctatccagtcgggaggagattgcttcttattaccactgtcctgaggcacccctagaagctaaggacgtcattctgacaagtggctgcagccaagctattgacctttgtttagctgtgttggccaacccagggcaaaacatcctggttccaagacctggtttctctctctacaagactctggctgagtctatgggaattgaggtcaaactctacaatttgttgccagagaaatcttgggaaattgacctgaaacaactggaatatctaattgatgaaaagacagcttgtctcattgtcaataatccatcaaacccctgtgggtcagtgttcagcaaacgtcatcttcagaagattctggcagtggctgcacggcagtgtgtccccatcttagctgatgagatctatggagacatggtgttttcggattgcaaatatgaaccactggccaccctcagcaccgatgtccccatcctgtcctgtggagggctggccaagcgctggctggttcctggctggaggttgggctggatcctcattcatgaccgaagagacatttttggcaatgagatccgagatgggctggtgaagctgagtcagcgcattttgggaccctgtaccattgtccagggagctctgaaaagcatcctatgtcgcaccccgggagagttttaccacaacactctgagcttcctcaagtccaatgctgatctctgttatggggcgttggctgccatccctggactccggccagtccgcccttctggggctatgtacctcatggttggaattgagatggaacatttcccagaatttgagaacgatgtggagttcacggagcggttagttgctgagcagtctgtccactgcctcccagcaacgtgctttgagtacccgaatttcatccgagtggtcatcacagtccccgaggtgatgatgctggaggcgtgcagccggatccaggagttctgtgagcagcactaccattgtgctgaaggcagccaggaggagtgtgataaatag
Sequence Length
1365
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,399 Da
NCBI Official Full Name
Homo sapiens tyrosine aminotransferase, mRNA
NCBI Official Synonym Full Names
tyrosine aminotransferase
NCBI Official Symbol
TAT
NCBI Protein Information
tyrosine aminotransferase
UniProt Protein Name
Tyrosine aminotransferase
Protein Family
UniProt Gene Name
TAT
UniProt Synonym Gene Names
TAT
UniProt Entry Name
ATTY_HUMAN

NCBI Description

This nuclear gene encodes a mitochondrial protein tyrosine aminotransferase which is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Mutations in this gene cause tyrosinemia (type II, Richner-Hanhart syndrome), a disorder accompanied by major skin and corneal lesions, with possible mental retardation. A regulator gene for tyrosine aminotransferase is X-linked. [provided by RefSeq, Jul 2008]

Uniprot Description

TAT: Transaminase involved in tyrosine breakdown. Converts tyrosine to p-hydroxyphenylpyruvate. Can catalyze the reverse reaction, using glutamic acid, with 2-oxoglutarate as cosubstrate (in vitro). Has much lower affinity and transaminase activity towards phenylalanine. Defects in TAT are the cause of tyrosinemia type 2 (TYRO2); also known as Richner-Hanhart syndrome. TYRO2 is an inborn error of metabolism characterized by elevations of tyrosine in the blood and urine, and oculocutaneous manifestations. Typical features include palmoplantar keratosis, painful corneal ulcers, and mental retardation. Belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family.

Protein type: EC 2.6.1.5; Amino Acid Metabolism - phenylalanine, tyrosine and tryptophan biosynthesis; Amino Acid Metabolism - tyrosine; Cofactor and Vitamin Metabolism - ubiquinone and other terpenoid-quinone biosynthesis; Mitochondrial; Amino Acid Metabolism - phenylalanine; Amino Acid Metabolism - cysteine and methionine; Transferase

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytosol

Molecular Function: tyrosine transaminase activity

Biological Process: 2-oxoglutarate metabolic process; glutamate metabolic process; L-phenylalanine catabolic process; tyrosine catabolic process

Disease: Tyrosinemia, Type Ii

Research Articles on TAT

Similar Products

Product Notes

The TAT tat (Catalog #AAA1266792) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccat acatgattca gatgagcagc aaaggcaacc tctcctcaat tctggacgtg catgtcaacg ttggtgggag aagctctgtg ccgggaaaaa tgaaaggcag aaaggccagg tggtctgtga ggccctcaga catggccaag aaaactttca accccatccg agccattgtg gacaacatga aggtgaaacc aaatccaaac aaaaccatga tttccctgtc cattggggac cctactgtgt ttggaaacct gcctacagac cctgaagtta cccaggcaat gaaagatgcc ctggactcgg gcaaatataa tggctatgcc ccatccatcg gcttcctatc cagtcgggag gagattgctt cttattacca ctgtcctgag gcacccctag aagctaagga cgtcattctg acaagtggct gcagccaagc tattgacctt tgtttagctg tgttggccaa cccagggcaa aacatcctgg ttccaagacc tggtttctct ctctacaaga ctctggctga gtctatggga attgaggtca aactctacaa tttgttgcca gagaaatctt gggaaattga cctgaaacaa ctggaatatc taattgatga aaagacagct tgtctcattg tcaataatcc atcaaacccc tgtgggtcag tgttcagcaa acgtcatctt cagaagattc tggcagtggc tgcacggcag tgtgtcccca tcttagctga tgagatctat ggagacatgg tgttttcgga ttgcaaatat gaaccactgg ccaccctcag caccgatgtc cccatcctgt cctgtggagg gctggccaag cgctggctgg ttcctggctg gaggttgggc tggatcctca ttcatgaccg aagagacatt tttggcaatg agatccgaga tgggctggtg aagctgagtc agcgcatttt gggaccctgt accattgtcc agggagctct gaaaagcatc ctatgtcgca ccccgggaga gttttaccac aacactctga gcttcctcaa gtccaatgct gatctctgtt atggggcgtt ggctgccatc cctggactcc ggccagtccg cccttctggg gctatgtacc tcatggttgg aattgagatg gaacatttcc cagaatttga gaacgatgtg gagttcacgg agcggttagt tgctgagcag tctgtccact gcctcccagc aacgtgcttt gagtacccga atttcatccg agtggtcatc acagtccccg aggtgatgat gctggaggcg tgcagccgga tccaggagtt ctgtgagcag cactaccatt gtgctgaagg cagccaggag gagtgtgata aatag. It is sometimes possible for the material contained within the vial of "TAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.