TASP1 cdna clone
TASP1 cDNA Clone
Gene Names
TASP1; C20orf13; dJ585I14.2
Synonyms
TASP1; TASP1 cDNA Clone; TASP1 cdna clone
Sequence
atgaccatggagaaggggatgagttctggagaagggctgccttccagatcatctcaggtttcggctggtaaaataacagccaaagagttggaaacaaagcagtcctataaagagaaacgaggaggctttgtgttggtgcatgcaggtgcaggttatcattctgaatccaaagccaaggagtataaacatgtatgcaaacgagcttgtcagaaggcaattgaaaagctgcaggccggtgctcttgcaactgacgcagtcactgcagcactggtggaacttgaggattctccttttacaaatgcaggaatgggatctaatctaaatctgttaggtgaaattgagtgtgatgccagcataatggatggaaaatccttaaattttggagcagttggagcactgagtggaatcaagaacccagtctcggttgccaacagactcttatgtgaagggcagaagggcaagctctcggctggcagaattcctccctgctttttagttggagaaggagcctacagatgggcagtagatcatggaataccctcttgccctcctaacatcatgaccacaagattcagtttagctgcatttaaaagaaacaagaggaaactagagctggcagaaagggtggacacagattttatgcaactaaagaaaagaagacaatcaagtgagaaggaaaatgactcaggcactttggacacggtaggcgctgtggttgtggaccacgaagggaatgttgctgctgctgtctccagtggaggcttggccttgaaacatccggggagagttgggcaggctgctctttatggatgtggctgctgggctgaaaatactggagctcataacccctactccacagctgtgagtacctcaggatgtggagagcatcttgtgcgcaccatactggctagagaatgttcacatgctttacaagctgaggatgctcaccaagccctgttggagactatgcaaaacaagtttatcagttcacctttccttgccagtgaagatggcgtgcttggcggagtgattgtcctccgttcatgcagatgttctgccgagcctgactcctcccaaaataagcagacacttctagtggaatttctgtggagccacacgacggagagcatgtgtgtcggatatatgtcagcccaggatgggaaagccaagactcacatttcaagacttcctcctggtgcggtggcaggacagtctgtggcaatcgaaggtggggtgtgccgcctggagagcccagtgaactga
Sequence Length
1263
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,946 Da
NCBI Official Full Name
Homo sapiens taspase, threonine aspartase, 1, mRNA
NCBI Official Synonym Full Names
taspase 1
NCBI Official Symbol
TASP1
NCBI Official Synonym Symbols
C20orf13; dJ585I14.2
NCBI Protein Information
threonine aspartase 1
UniProt Protein Name
Threonine aspartase 1
Protein Family
UniProt Gene Name
TASP1
UniProt Synonym Gene Names
C20orf13; Taspase-1
UniProt Entry Name
TASP1_HUMAN
NCBI Description
This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
TASP1: Protease involved in MLL processing and, consequently, in the correct expression of the early HOXA gene cluster. Belongs to the Ntn-hydrolase family.
Protein type: Protease; EC 3.4.25.-
Chromosomal Location of Human Ortholog: 20p12.1
Molecular Function: threonine endopeptidase activity
Biological Process: positive regulation of transcription, DNA-dependent; proteolysis
Research Articles on TASP1
Similar Products
Product Notes
The TASP1 tasp1 (Catalog #AAA1275801) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccatgg agaaggggat gagttctgga gaagggctgc cttccagatc atctcaggtt tcggctggta aaataacagc caaagagttg gaaacaaagc agtcctataa agagaaacga ggaggctttg tgttggtgca tgcaggtgca ggttatcatt ctgaatccaa agccaaggag tataaacatg tatgcaaacg agcttgtcag aaggcaattg aaaagctgca ggccggtgct cttgcaactg acgcagtcac tgcagcactg gtggaacttg aggattctcc ttttacaaat gcaggaatgg gatctaatct aaatctgtta ggtgaaattg agtgtgatgc cagcataatg gatggaaaat ccttaaattt tggagcagtt ggagcactga gtggaatcaa gaacccagtc tcggttgcca acagactctt atgtgaaggg cagaagggca agctctcggc tggcagaatt cctccctgct ttttagttgg agaaggagcc tacagatggg cagtagatca tggaataccc tcttgccctc ctaacatcat gaccacaaga ttcagtttag ctgcatttaa aagaaacaag aggaaactag agctggcaga aagggtggac acagatttta tgcaactaaa gaaaagaaga caatcaagtg agaaggaaaa tgactcaggc actttggaca cggtaggcgc tgtggttgtg gaccacgaag ggaatgttgc tgctgctgtc tccagtggag gcttggcctt gaaacatccg gggagagttg ggcaggctgc tctttatgga tgtggctgct gggctgaaaa tactggagct cataacccct actccacagc tgtgagtacc tcaggatgtg gagagcatct tgtgcgcacc atactggcta gagaatgttc acatgcttta caagctgagg atgctcacca agccctgttg gagactatgc aaaacaagtt tatcagttca cctttccttg ccagtgaaga tggcgtgctt ggcggagtga ttgtcctccg ttcatgcaga tgttctgccg agcctgactc ctcccaaaat aagcagacac ttctagtgga atttctgtgg agccacacga cggagagcat gtgtgtcgga tatatgtcag cccaggatgg gaaagccaag actcacattt caagacttcc tcctggtgcg gtggcaggac agtctgtggc aatcgaaggt ggggtgtgcc gcctggagag cccagtgaac tga. It is sometimes possible for the material contained within the vial of "TASP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
