Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TARS2 cdna clone

TARS2 cDNA Clone

Gene Names
TARS2; thrRS; TARSL1; COXPD21
Synonyms
TARS2; TARS2 cDNA Clone; TARS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgtatcagaggtggcggtgtctccggctccaaggtttacaggcttgcaggctacacacggcagttgtgtcgacccctccacgctggttggcagagcggcttggcctttttgaggagctgtgggctgctcaggtaaagagattagcaagcatggcacagaaggaaccccggactattaagatatcacttcctggaggccagaaaattgatgctgtggcatggaacacaaccccctaccaactagcccggcagatcagttcaacactggcagatactgcagtggctgctcaagtgaatggagaaccttatgatctggagcggcccttggagacagattctgacctcagatttctgacattcgattccccagaggggaaagcagtgttctggcactccagcacccatgtcctgggggcagcagctgaacaattcctaggtgctgttctctgcagaggtccaagtacagaatatggcttttaccatgatttcttcctgggaaaggagaggacaatccggggctcagagctgcctgttttggagcggatttgccaggaacttacagctgctgctcgacccttccggaggctagaggcttcacgggatcagcttcgccagttgttcaaggataacccctttaagcttcacttgattgaggagaaagtgacaggtccaacagcaacagtatatgggtgtggcacattggttgacctttgccagggcccccaccttcggcatactggacagattggaggactgaagctgctatcgaactcatcatccttatggaggtcttcaggggccccagagacactgcagagagtgtcagggatttccttccccacaacagaattgctgagggtctgggaagcatggagggaggaagcagaattgcgggaccaccggcgcattgggaaggaacaggagctcttcttcttccatgaactgagccctgggagctgcttcttcctgccacgagggacaagggtgtataatgcactagtggcgtttatcagggctgagtatgcccatcgtggtttctccgaggtgaaaactcccacactgttttctacgaagctctgggaacagtcagggcactgggagcattatcaggaagacatgtttgccgtgcagcccccaggctctgacaggcctcccagctcccagagtgacgattctaccaggcatatcacagatacactcgccctcaagcctatgaactgccctgcacactgcctgatgttcgcccaccggcccagatcctggcgggaactgcccctgcgactagctgactttggggctctacaccgggccgaagcctctggtggtctggggggactgacccgactgcggtgcttccagcaggatgacgctcacatcttctgtacaacagatcagctggaagcagagatccaaagctgtcttgatttcctccgttccgtctatgccgttcttggcttctccttccgcctggcactgtccacccggccatctggcttcctgggggacccttgcctttgggaccaggccgaacaggtccttaaacaggccctgaaggaatttggagaaccctgggacctcaactctggagatggtgccttctatggacctaagattgacgtgcacctccacgatgccctgggccggccacatcagtgtgggacaattcagcttgacttccaactgcccctgagatttgacctccagtataaggggcaggcgggtgccctggagcgtccagtcctcattcaccgagcagtgctcggttctgtggaaagactgttgggagtgctggcagaaagctgcggggggaaatggccactgtggctgtccccgttccaggtggtggtcatccctgtggggagtgagcaagaggaatacgccaaagaggcacagcagagcctgcgggctgcaggactggtcagtgacctggatgcagactctggactgaccctcagccggagaatccgccgggcccagcttgcccactacaattttcagtttgtggttggccagaaagagcaaagtaagagaacagtgaacattcggactcgagataatcgtcgccttggggagtgggacttgcctgaggctgtgcagcgactggtggagctacagaacacgagggtcccaaatgccgaagaaattttctga
Sequence Length
2157
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,372 Da
NCBI Official Full Name
Homo sapiens threonyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
threonyl-tRNA synthetase 2, mitochondrial (putative)
NCBI Official Symbol
TARS2
NCBI Official Synonym Symbols
thrRS; TARSL1; COXPD21
NCBI Protein Information
threonine--tRNA ligase, mitochondrial
UniProt Protein Name
Threonine--tRNA ligase, mitochondrial
UniProt Gene Name
TARS2
UniProt Synonym Gene Names
TARSL1; ThrRS
UniProt Entry Name
SYTM_HUMAN

NCBI Description

This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]

Uniprot Description

TARS2: Belongs to the class-II aminoacyl-tRNA synthetase family.

Protein type: EC 6.1.1.3; Mitochondrial; Ligase

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: mitochondrion

Molecular Function: RNA binding; threonine-tRNA ligase activity

Disease: Combined Oxidative Phosphorylation Deficiency 21

Research Articles on TARS2

Similar Products

Product Notes

The TARS2 tars2 (Catalog #AAA1266712) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgt atcagaggtg gcggtgtctc cggctccaag gtttacaggc ttgcaggcta cacacggcag ttgtgtcgac ccctccacgc tggttggcag agcggcttgg cctttttgag gagctgtggg ctgctcaggt aaagagatta gcaagcatgg cacagaagga accccggact attaagatat cacttcctgg aggccagaaa attgatgctg tggcatggaa cacaaccccc taccaactag cccggcagat cagttcaaca ctggcagata ctgcagtggc tgctcaagtg aatggagaac cttatgatct ggagcggccc ttggagacag attctgacct cagatttctg acattcgatt ccccagaggg gaaagcagtg ttctggcact ccagcaccca tgtcctgggg gcagcagctg aacaattcct aggtgctgtt ctctgcagag gtccaagtac agaatatggc ttttaccatg atttcttcct gggaaaggag aggacaatcc ggggctcaga gctgcctgtt ttggagcgga tttgccagga acttacagct gctgctcgac ccttccggag gctagaggct tcacgggatc agcttcgcca gttgttcaag gataacccct ttaagcttca cttgattgag gagaaagtga caggtccaac agcaacagta tatgggtgtg gcacattggt tgacctttgc cagggccccc accttcggca tactggacag attggaggac tgaagctgct atcgaactca tcatccttat ggaggtcttc aggggcccca gagacactgc agagagtgtc agggatttcc ttccccacaa cagaattgct gagggtctgg gaagcatgga gggaggaagc agaattgcgg gaccaccggc gcattgggaa ggaacaggag ctcttcttct tccatgaact gagccctggg agctgcttct tcctgccacg agggacaagg gtgtataatg cactagtggc gtttatcagg gctgagtatg cccatcgtgg tttctccgag gtgaaaactc ccacactgtt ttctacgaag ctctgggaac agtcagggca ctgggagcat tatcaggaag acatgtttgc cgtgcagccc ccaggctctg acaggcctcc cagctcccag agtgacgatt ctaccaggca tatcacagat acactcgccc tcaagcctat gaactgccct gcacactgcc tgatgttcgc ccaccggccc agatcctggc gggaactgcc cctgcgacta gctgactttg gggctctaca ccgggccgaa gcctctggtg gtctgggggg actgacccga ctgcggtgct tccagcagga tgacgctcac atcttctgta caacagatca gctggaagca gagatccaaa gctgtcttga tttcctccgt tccgtctatg ccgttcttgg cttctccttc cgcctggcac tgtccacccg gccatctggc ttcctggggg acccttgcct ttgggaccag gccgaacagg tccttaaaca ggccctgaag gaatttggag aaccctggga cctcaactct ggagatggtg ccttctatgg acctaagatt gacgtgcacc tccacgatgc cctgggccgg ccacatcagt gtgggacaat tcagcttgac ttccaactgc ccctgagatt tgacctccag tataaggggc aggcgggtgc cctggagcgt ccagtcctca ttcaccgagc agtgctcggt tctgtggaaa gactgttggg agtgctggca gaaagctgcg gggggaaatg gccactgtgg ctgtccccgt tccaggtggt ggtcatccct gtggggagtg agcaagagga atacgccaaa gaggcacagc agagcctgcg ggctgcagga ctggtcagtg acctggatgc agactctgga ctgaccctca gccggagaat ccgccgggcc cagcttgccc actacaattt tcagtttgtg gttggccaga aagagcaaag taagagaaca gtgaacattc ggactcgaga taatcgtcgc cttggggagt gggacttgcc tgaggctgtg cagcgactgg tggagctaca gaacacgagg gtcccaaatg ccgaagaaat tttctga. It is sometimes possible for the material contained within the vial of "TARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.