Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAP1 cdna clone

TAP1 cDNA Clone

Gene Names
TAP1; APT1; PSF1; ABC17; ABCB2; PSF-1; RING4; TAP1N; D6S114E; TAP1*0102N
Synonyms
TAP1; TAP1 cDNA Clone; TAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagcttctcgccagcgcaggatcagcctgttcctgggactttccgagagccccgccctcgttccctcccccagccgccagtaggggaggactcggcggtacccggagcttcaggccccaccggggcgcggagagtcccaggcccggccgggaccgggacggcgtccgagtgccaatggctagctctaggtgtcccgctccccgcgggtgccgctgcctccccggagcttctctcgcatggctggggacagtactgctacttctcgccgactgggtgctgctccggaccgcgctgccccgcatattctccctgctggtgcccaccgcgctgccactgctccgggtctgggcggtgggcctgagccgctgggccgtgctctggctgggggcctgcggggtcctcagggcaacggttggctccaagagcgaaaacgcaggtgcccagggctggctggctgctttgaagccattagctgcggcactgggcttggccctgccgggacttgccttgttccgagagctgatctcatggggagcccccgggtccgcggatagcaccaggctactgcactggggaagtcaccctaccgccttcgttgtcagttatgcagcggcactgcccgcagcagccctgtggcacaaactcgggagcctctgggtgcccggcggtcagggcggctctggaaaccctgtgcgtcggcttctaggctgcctgggctcggagacgcgccgcctctcgctgttcctggtcctggtggtcctctcctctcttggggagatggccattccattctttacgggccgcctcactgactggattctacaagatggctcagccgataccttcactcgaaacttaactctcatgtccattctcaccatagccagtgcagtgctggagttcgtgggtgacgggatctataacaacaccatgggccacgtgcacagccacttgcagggagaggtgtttggggctgtcctgcgccaggagacggagtttttccaacagaaccagacaggtaacatcatgtctcgggtaacagaggacacgtccaccctgagtgattctctgagtgagaatctgagcttatttctgtggtacctggtgcgaggcctatgtctcttggggatcatgctctggggatcagtgtccctcaccatggtcaccctgatcaccctgcctctgcttttccttctgcccaagaaggtgggaaaatggtaccagttgctggaagtgcaggtgcgggaatctctggcaaagtccagccaggtggccattgaggctctgtcggccatgcctacagttcgaagctttgccaacgaggagggcgaagcccagaagtttagggaaaagctgcaagaaataaagacactcaaccagaaggaggctgtggcctatgcagtcaactcctggaccactagtatttcaggtatgctgctgaaagtgggaatcctctacattggtgggcagctggtgaccagtggggctgtaagcagtgggaaccttgtcacatttgttctctaccagatgcagttcacccaggctgtggaggtactgctctccatctaccccagagtacagaaggctgtgggctcctcagagaaaatatttgagtacctggaccgcacccctcgctgcccacccagtggtctgttgactcccttacacttggagggccttgtccagttccaagatgtctcctttgcctacccaaaccgcccagatgtcttagtgctacaggggctgacattcaccctacgccctggcgaggtgacggcgctggtgggacccaatgggtctgggaagagcacagtggctgccctgctgcagaatctgtaccagcccaccgggggacagctgctgttggatgggaagccccttccccaatatgagcaccgctacctgcacaggcaggtggctgcagtgggacaagagccacaggtatttggaagaagtcttcaagaaaatattgcctatggcctgacccagaagccaactatggaggaaatcacagctgctgcagtaaagtctggggcccatagtttcatctctggactccctcagggctatgacacagaggtagacgaggctgggagccagctgtcagggggtcagcgacaggcagtggcgttggcccgagcattgatccggaaaccgtgtgtacttatcctggatgatgccaccagtgccctggatgcaaacagccagttacaggtggagcagctcctgtacgaaagccctgagcggtactcccgctcagtgcttctcatcacccagcacctcagcctggtggagcaggctgaccacatcctctttctggaaggaggcgctatccgggaggggggaacccaccagcagctcatggagaaaaaggggtgctactgggccatggtgcaggctcctgcagatgctccagaatga
Sequence Length
2427
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
87,218 Da
NCBI Official Full Name
Homo sapiens transporter 1, ATP-binding cassette, sub-family B (MDR/TAP), mRNA
NCBI Official Synonym Full Names
transporter 1, ATP binding cassette subfamily B member
NCBI Official Symbol
TAP1
NCBI Official Synonym Symbols
APT1; PSF1; ABC17; ABCB2; PSF-1; RING4; TAP1N; D6S114E; TAP1*0102N
NCBI Protein Information
antigen peptide transporter 1
UniProt Protein Name
Antigen peptide transporter 1
Protein Family
UniProt Gene Name
TAP1
UniProt Synonym Gene Names
ABCB2; PSF1; RING4; Y3; APT1; PSF-1
UniProt Entry Name
TAP1_HUMAN

NCBI Description

The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]

Uniprot Description

TAP1: a 'transporter associated with antigen processing' (TAP) protein. Member of the ATP binding cassette (ABC) family of transmembrane transporters. Also acts as a molecular scaffold for the final stage of MHC class I folding, namely the binding of peptide. Nascent MHC class I molecules associate with TAP via tapasin. Inhibited by the covalent attachment of herpes simplex virus ICP47 protein, which blocks the peptide-binding site of TAP. Inhibited by human cytomegalovirus US6 glycoprotein, which binds to the lumenal side of the TAP complex and inhibits peptide translocation by specifically blocking ATP-binding to TAP1 and prevents the conformational rearrangement of TAP induced by peptide binding. Inhibited by human adenovirus E3-19K glycoprotein, which binds the TAP complex and acts as a tapasin inhibitor, preventing MHC class I/TAP association. Expression of TAP1 is down-regulated by human Epstein-Barr virus vIL-10 protein, thereby affecting the transport of peptides into the endoplasmic reticulum and subsequent peptide loading by MHC class I molecules. Defects in TAP1 are a cause of bare lymphocyte syndrome.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transporter

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; integral to membrane; membrane; TAP complex

Molecular Function: ADP binding; ATP binding; ATPase activity, coupled to transmembrane movement of substances; peptide transporter activity; protein binding; protein homodimerization activity; TAP1 binding; TAP2 binding

Biological Process: antigen processing and presentation of endogenous peptide antigen via MHC class I; antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent; antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent; antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent; antigen processing and presentation of peptide antigen via MHC class I; cytosol to ER transport; intracellular transport of viral proteins in host cell; peptide transport; positive regulation of antigen processing and presentation of peptide antigen via MHC class I; transmembrane transport

Disease: Bare Lymphocyte Syndrome, Type I

Research Articles on TAP1

Similar Products

Product Notes

The TAP1 tap1 (Catalog #AAA1272729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagc ttctcgccag cgcaggatca gcctgttcct gggactttcc gagagccccg ccctcgttcc ctcccccagc cgccagtagg ggaggactcg gcggtacccg gagcttcagg ccccaccggg gcgcggagag tcccaggccc ggccgggacc gggacggcgt ccgagtgcca atggctagct ctaggtgtcc cgctccccgc gggtgccgct gcctccccgg agcttctctc gcatggctgg ggacagtact gctacttctc gccgactggg tgctgctccg gaccgcgctg ccccgcatat tctccctgct ggtgcccacc gcgctgccac tgctccgggt ctgggcggtg ggcctgagcc gctgggccgt gctctggctg ggggcctgcg gggtcctcag ggcaacggtt ggctccaaga gcgaaaacgc aggtgcccag ggctggctgg ctgctttgaa gccattagct gcggcactgg gcttggccct gccgggactt gccttgttcc gagagctgat ctcatgggga gcccccgggt ccgcggatag caccaggcta ctgcactggg gaagtcaccc taccgccttc gttgtcagtt atgcagcggc actgcccgca gcagccctgt ggcacaaact cgggagcctc tgggtgcccg gcggtcaggg cggctctgga aaccctgtgc gtcggcttct aggctgcctg ggctcggaga cgcgccgcct ctcgctgttc ctggtcctgg tggtcctctc ctctcttggg gagatggcca ttccattctt tacgggccgc ctcactgact ggattctaca agatggctca gccgatacct tcactcgaaa cttaactctc atgtccattc tcaccatagc cagtgcagtg ctggagttcg tgggtgacgg gatctataac aacaccatgg gccacgtgca cagccacttg cagggagagg tgtttggggc tgtcctgcgc caggagacgg agtttttcca acagaaccag acaggtaaca tcatgtctcg ggtaacagag gacacgtcca ccctgagtga ttctctgagt gagaatctga gcttatttct gtggtacctg gtgcgaggcc tatgtctctt ggggatcatg ctctggggat cagtgtccct caccatggtc accctgatca ccctgcctct gcttttcctt ctgcccaaga aggtgggaaa atggtaccag ttgctggaag tgcaggtgcg ggaatctctg gcaaagtcca gccaggtggc cattgaggct ctgtcggcca tgcctacagt tcgaagcttt gccaacgagg agggcgaagc ccagaagttt agggaaaagc tgcaagaaat aaagacactc aaccagaagg aggctgtggc ctatgcagtc aactcctgga ccactagtat ttcaggtatg ctgctgaaag tgggaatcct ctacattggt gggcagctgg tgaccagtgg ggctgtaagc agtgggaacc ttgtcacatt tgttctctac cagatgcagt tcacccaggc tgtggaggta ctgctctcca tctaccccag agtacagaag gctgtgggct cctcagagaa aatatttgag tacctggacc gcacccctcg ctgcccaccc agtggtctgt tgactccctt acacttggag ggccttgtcc agttccaaga tgtctccttt gcctacccaa accgcccaga tgtcttagtg ctacaggggc tgacattcac cctacgccct ggcgaggtga cggcgctggt gggacccaat gggtctggga agagcacagt ggctgccctg ctgcagaatc tgtaccagcc caccggggga cagctgctgt tggatgggaa gccccttccc caatatgagc accgctacct gcacaggcag gtggctgcag tgggacaaga gccacaggta tttggaagaa gtcttcaaga aaatattgcc tatggcctga cccagaagcc aactatggag gaaatcacag ctgctgcagt aaagtctggg gcccatagtt tcatctctgg actccctcag ggctatgaca cagaggtaga cgaggctggg agccagctgt cagggggtca gcgacaggca gtggcgttgg cccgagcatt gatccggaaa ccgtgtgtac ttatcctgga tgatgccacc agtgccctgg atgcaaacag ccagttacag gtggagcagc tcctgtacga aagccctgag cggtactccc gctcagtgct tctcatcacc cagcacctca gcctggtgga gcaggctgac cacatcctct ttctggaagg aggcgctatc cgggaggggg gaacccacca gcagctcatg gagaaaaagg ggtgctactg ggccatggtg caggctcctg cagatgctcc agaatga. It is sometimes possible for the material contained within the vial of "TAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.