Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT9 cdna clone

SYT9 cDNA Clone

Synonyms
SYT9; SYT9 cDNA Clone; SYT9 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccggggccagggacgcgctctgtcaccaggcgctgcagctgctggccgagctctgtgcccgtggggccctggagcacgacagctgccaggatttcatttaccacctgcgggaccgtgccagaccccggctccgcgacccagatatctcagtgagcctgctgacccttgtggtcactgcctgtggtctcgctctctttggcgtgtctctcttcgtatcttggaaactctgctgggttccgtggcgagaacgaggcctgccctctggtagcaaagacaacaaccaggagccccttaactacatggacacagagaccaatgagcaggagaacagtgaggacttcctagaccctcccacgccctgccctgactcctccatgaagatcagccacacctcccctgacattcccctctccacccagacggggatccaggagaactgtgcccatggcgtccgcgtgcagcgccaagtcacagagccaacctcgtcggcccggcataattcaatccgaagacaactcaacttgtcaaacccggacttcaatatccagcagcttcaaaaacaggaacagttgactggaattggtagaattaaaccagagttatataagcagaggtcattggataatgatgacgggagacggagtaacagcaaggcttgtgggaaactgaacttcattttaaaatatgactgtgacttagagcagctcatagtgaagattcacaaagctgtcaatttgcccgccaaggacttttctgggacttcagatccttatgtcaagatctatttgcttcctgatcggaaaacaaaacaccagactaaagttcacagaaagaccctgaaccctgtgtttgatgaagtgtttttatttccggttccctacaatgaccttgaagcacggaagcttcacttctctgtgtacgactttgacaggttctctcgtcatgacttaatcggccaagtggtggtggatcacttcctagacttggctgatttccccagggagtgcatcctttggaaggatatcgaatatgtcaccaatgacaacgtggatctgggagagctgatgttttccctgtgctatcttccaacggctggcaggctgaccattaccattataaaagcaaggaatttaaaggcaatggacataacaggagcatcagatccctatgtgaaagtctcgctgatgtgtgatggcagacgactgaagaagaggaaaacatccaccaagaggaacaccttgaatcctgtttacaacgaagccatagtctttgatgtccctcccgagaacattgaccaaatccacttgtccatagcagtcatggactatgaccgtgtaggtcacaatgagatcatcggcgtgtgtcaagtaggcaacgaggctgagaggctgggcagagaccactggagtgaaatgttgtcatatcctcggaagcccattgcacactggcattccctggtggagaaacgatga
Sequence Length
1476
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,188 Da
NCBI Official Full Name
Homo sapiens synaptotagmin IX, mRNA
NCBI Official Synonym Full Names
synaptotagmin 9
NCBI Official Symbol
SYT9
NCBI Protein Information
synaptotagmin-9
UniProt Protein Name
Synaptotagmin-9
Protein Family
UniProt Gene Name
SYT9
UniProt Synonym Gene Names
SytIX
UniProt Entry Name
SYT9_HUMAN

Uniprot Description

SYT9: May be involved in Ca(2+)-dependent exocytosis of secretory vesicles through Ca(2+) and phospholipid binding to the C2 domain or may serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Belongs to the synaptotagmin family.

Protein type: Membrane protein, integral; Vesicle

Chromosomal Location of Human Ortholog: 11p15.4

Cellular Component: plasma membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; vesicle fusion

Research Articles on SYT9

Similar Products

Product Notes

The SYT9 syt9 (Catalog #AAA1275029) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgggg ccagggacgc gctctgtcac caggcgctgc agctgctggc cgagctctgt gcccgtgggg ccctggagca cgacagctgc caggatttca tttaccacct gcgggaccgt gccagacccc ggctccgcga cccagatatc tcagtgagcc tgctgaccct tgtggtcact gcctgtggtc tcgctctctt tggcgtgtct ctcttcgtat cttggaaact ctgctgggtt ccgtggcgag aacgaggcct gccctctggt agcaaagaca acaaccagga gccccttaac tacatggaca cagagaccaa tgagcaggag aacagtgagg acttcctaga ccctcccacg ccctgccctg actcctccat gaagatcagc cacacctccc ctgacattcc cctctccacc cagacgggga tccaggagaa ctgtgcccat ggcgtccgcg tgcagcgcca agtcacagag ccaacctcgt cggcccggca taattcaatc cgaagacaac tcaacttgtc aaacccggac ttcaatatcc agcagcttca aaaacaggaa cagttgactg gaattggtag aattaaacca gagttatata agcagaggtc attggataat gatgacggga gacggagtaa cagcaaggct tgtgggaaac tgaacttcat tttaaaatat gactgtgact tagagcagct catagtgaag attcacaaag ctgtcaattt gcccgccaag gacttttctg ggacttcaga tccttatgtc aagatctatt tgcttcctga tcggaaaaca aaacaccaga ctaaagttca cagaaagacc ctgaaccctg tgtttgatga agtgttttta tttccggttc cctacaatga ccttgaagca cggaagcttc acttctctgt gtacgacttt gacaggttct ctcgtcatga cttaatcggc caagtggtgg tggatcactt cctagacttg gctgatttcc ccagggagtg catcctttgg aaggatatcg aatatgtcac caatgacaac gtggatctgg gagagctgat gttttccctg tgctatcttc caacggctgg caggctgacc attaccatta taaaagcaag gaatttaaag gcaatggaca taacaggagc atcagatccc tatgtgaaag tctcgctgat gtgtgatggc agacgactga agaagaggaa aacatccacc aagaggaaca ccttgaatcc tgtttacaac gaagccatag tctttgatgt ccctcccgag aacattgacc aaatccactt gtccatagca gtcatggact atgaccgtgt aggtcacaat gagatcatcg gcgtgtgtca agtaggcaac gaggctgaga ggctgggcag agaccactgg agtgaaatgt tgtcatatcc tcggaagccc attgcacact ggcattccct ggtggagaaa cgatga. It is sometimes possible for the material contained within the vial of "SYT9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.