Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT6 cdna clone

SYT6 cDNA Clone

Gene Names
SYT6; sytVI
Synonyms
SYT6; SYT6 cDNA Clone; SYT6 cdna clone
Ordering
For Research Use Only!
Sequence
atgccctggaggaacaaggaggcctccagtccctcttctgctaatccccccttggaagccctccagagccccagcttcagaggcaacatggcggacaagctgaaggaccccagcaccctgggcttcctggaggcggccgtgaagatcagccacacgtccccagatatcccagctgaggtgcagatgtcggtcaaggagcacatcatgcgtcacacccggctgcagcggcaaactacagagccagcgtcatccaccaggcacacgtccttcaagcgccacctgccaaggcagatgcatgtctccagtgtagactatggcaatgagcttccaccagcagcagagcagcccaccagcattggccgcatcaagcctgagctctacaagcagaagtcggtggatggggaggatgccaagtctgaggccaccaagagctgcgggaagatcaacttcagcctacgctacgattacgagaccgagaccctgattgtgcgtatcctgaaggcttttgacctccctgccaaggacttttgtggaagctctgacccttatgtcaagatctacctcctgcctgaccgcaaatgcaagctgcagacccgggtgcaccgcaagaccctgaaccccacctttgatgagaacttccacttccctgtgccctatgaggagctggctgaccgcaagctgcatctcagtgtcttcgactttgaccgcttctcccgccatgacatgattggcgaggtcatcctggacaacctctttgaggcctctgacctgtctcgggaaacctccatctggaaggatatccaatatgccacaagtgaaagcgtggacttgggagagatcatgttctccctttgctacctgcccactgcaggcaggctcaccctcacagtgattaagtgtcggaacctcaaggcgatggacatcacaggctattcagatccctatgtgaaagtgtccttgctctgtgatgggcggaggctgaagaagaagaaaacaaccataaagaaaaacactctcaatcctgtctacaatgaggccatcatctttgacattcccccggaaaacatggatcaagtcagcctgctcatctcagtcatggactatgatcgagtgggccacaatgagatcataggagtctgtcgtgtggggatcactgctgaaggcctgggcagggaccactggaacgagatgctggcatacccccggaagcccatcgcacactggcactccttggtggaggtaaagaaatccttcaaagagggaaaccctcggttgtga
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,442 Da
NCBI Official Full Name
Homo sapiens synaptotagmin VI, mRNA
NCBI Official Synonym Full Names
synaptotagmin 6
NCBI Official Symbol
SYT6
NCBI Official Synonym Symbols
sytVI
NCBI Protein Information
synaptotagmin-6
UniProt Protein Name
Synaptotagmin-6
Protein Family
UniProt Gene Name
SYT6
UniProt Synonym Gene Names
SytVI
UniProt Entry Name
SYT6_HUMAN

NCBI Description

The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

SYT6: May be involved in Ca(2+)-dependent exocytosis of secretory vesicles through Ca(2+) and phospholipid binding to the C2 domain or may serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. May mediate Ca(2+)- regulation of exocytosis in acrosomal reaction in sperm. Belongs to the synaptotagmin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p13.2

Cellular Component: cytosol; extrinsic to membrane; integral to membrane; plasma membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; protein homodimerization activity; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; vesicle fusion

Research Articles on SYT6

Similar Products

Product Notes

The SYT6 syt6 (Catalog #AAA1272161) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctgga ggaacaagga ggcctccagt ccctcttctg ctaatccccc cttggaagcc ctccagagcc ccagcttcag aggcaacatg gcggacaagc tgaaggaccc cagcaccctg ggcttcctgg aggcggccgt gaagatcagc cacacgtccc cagatatccc agctgaggtg cagatgtcgg tcaaggagca catcatgcgt cacacccggc tgcagcggca aactacagag ccagcgtcat ccaccaggca cacgtccttc aagcgccacc tgccaaggca gatgcatgtc tccagtgtag actatggcaa tgagcttcca ccagcagcag agcagcccac cagcattggc cgcatcaagc ctgagctcta caagcagaag tcggtggatg gggaggatgc caagtctgag gccaccaaga gctgcgggaa gatcaacttc agcctacgct acgattacga gaccgagacc ctgattgtgc gtatcctgaa ggcttttgac ctccctgcca aggacttttg tggaagctct gacccttatg tcaagatcta cctcctgcct gaccgcaaat gcaagctgca gacccgggtg caccgcaaga ccctgaaccc cacctttgat gagaacttcc acttccctgt gccctatgag gagctggctg accgcaagct gcatctcagt gtcttcgact ttgaccgctt ctcccgccat gacatgattg gcgaggtcat cctggacaac ctctttgagg cctctgacct gtctcgggaa acctccatct ggaaggatat ccaatatgcc acaagtgaaa gcgtggactt gggagagatc atgttctccc tttgctacct gcccactgca ggcaggctca ccctcacagt gattaagtgt cggaacctca aggcgatgga catcacaggc tattcagatc cctatgtgaa agtgtccttg ctctgtgatg ggcggaggct gaagaagaag aaaacaacca taaagaaaaa cactctcaat cctgtctaca atgaggccat catctttgac attcccccgg aaaacatgga tcaagtcagc ctgctcatct cagtcatgga ctatgatcga gtgggccaca atgagatcat aggagtctgt cgtgtgggga tcactgctga aggcctgggc agggaccact ggaacgagat gctggcatac ccccggaagc ccatcgcaca ctggcactcc ttggtggagg taaagaaatc cttcaaagag ggaaaccctc ggttgtga. It is sometimes possible for the material contained within the vial of "SYT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.