SYT17 cdna clone
SYT17 cDNA Clone
Gene Names
SYT17; sytXVII
Synonyms
SYT17; SYT17 cDNA Clone; SYT17 cdna clone
Sequence
atggcgtacatccagttggaaccattaaacgagggttttctttctagaatctctggtctgctgctgtgcagatggacctgccggcactgctgtcagaagtgctacgagtccagctgttgccagtcaagtgaggatgaagttgaaattctgggacctttccctgctcagacccctccctggctgatggccagccggagcagtgacaaggatggtgactctgtccacacggccagcgaagtcccgctgaccccacggaccaattccccggatggaagacgctcgtcctcagacacatccaagtctacatacagcctgacgcggaggatttcgagtcttgagtcaagacgtcccagctctccactcatcgatattaaacccatcgagtttggcgttctcagcgccaagaaggagcccatccaaccttcggtgctcagacggacctataaccccgacgactatttcaggaagttcgaaccccacctgtactccctcgactccaacagcgacgatgtggactctctgacagacgaggagatcctgtccaagtaccagctgggcatgctgcacttcagcactcagtacgacctgctgcacaaccacctcaccgtgcgtgtgatcgaggccagggacctgccacctcccatctcccacgatggctcgcgccaggacatggcgcactccaacccctacgtcaagatctgtctcctgccagaccagaagaactcaaagcagaccggggtcaaacgcaagacccagaagcccgtgtttgaggagcgctacaccttcgagatccccttcctggaggcccagaggaggaccctgctcctgaccgtggtggattttgataagttctcccgccactgtgtcattgggaaagtttctgtgcctttgtgtgaagttgacctggtcaagggcgggcactggtggaaggcgctgattcccagttctcagaatgaagtggagctgggggagctgcttctgtcactgaattatctcccaagtgctggcagactgaatgttgatgtcattcgagccaagcaacttcttcagacagatgtgagccaaggttcagacccctttgtgaaaatccagctggtgcatggactcaaacttgtgaaaaccaagaagacgtccttcttaaggggcacaattgatcctttctacaatgaatccttcagcttcaaagttccccaagaagaactggaaaatgccagcctagtgtttacagttttcggccacaacatgaagagcagcaatgacttcatcgggaggatcgtcattggccagtactcttcaggcccctctgagaccaaccactggaggcgcatgctcaacacgcaccgcacagccgtggagcagtggcatagcctgaggtcccgagctgagtgtgaccgcgtgtctcctgcctccctggaggtgacctga
Sequence Length
1425
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,849 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XVII, mRNA
NCBI Official Synonym Full Names
synaptotagmin 17
NCBI Official Symbol
SYT17
NCBI Official Synonym Symbols
sytXVII
NCBI Protein Information
synaptotagmin-17
UniProt Protein Name
Synaptotagmin-17
Protein Family
UniProt Gene Name
SYT17
UniProt Synonym Gene Names
SytXVII
UniProt Entry Name
SYT17_HUMAN
Uniprot Description
SYT17: Belongs to the synaptotagmin family.
Chromosomal Location of Human Ortholog: 16p12.3
Cellular Component: plasma membrane
Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; protein binding; syntaxin binding
Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; vesicle fusion
Research Articles on SYT17
Similar Products
Product Notes
The SYT17 syt17 (Catalog #AAA1265770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtaca tccagttgga accattaaac gagggttttc tttctagaat ctctggtctg ctgctgtgca gatggacctg ccggcactgc tgtcagaagt gctacgagtc cagctgttgc cagtcaagtg aggatgaagt tgaaattctg ggacctttcc ctgctcagac ccctccctgg ctgatggcca gccggagcag tgacaaggat ggtgactctg tccacacggc cagcgaagtc ccgctgaccc cacggaccaa ttccccggat ggaagacgct cgtcctcaga cacatccaag tctacataca gcctgacgcg gaggatttcg agtcttgagt caagacgtcc cagctctcca ctcatcgata ttaaacccat cgagtttggc gttctcagcg ccaagaagga gcccatccaa ccttcggtgc tcagacggac ctataacccc gacgactatt tcaggaagtt cgaaccccac ctgtactccc tcgactccaa cagcgacgat gtggactctc tgacagacga ggagatcctg tccaagtacc agctgggcat gctgcacttc agcactcagt acgacctgct gcacaaccac ctcaccgtgc gtgtgatcga ggccagggac ctgccacctc ccatctccca cgatggctcg cgccaggaca tggcgcactc caacccctac gtcaagatct gtctcctgcc agaccagaag aactcaaagc agaccggggt caaacgcaag acccagaagc ccgtgtttga ggagcgctac accttcgaga tccccttcct ggaggcccag aggaggaccc tgctcctgac cgtggtggat tttgataagt tctcccgcca ctgtgtcatt gggaaagttt ctgtgccttt gtgtgaagtt gacctggtca agggcgggca ctggtggaag gcgctgattc ccagttctca gaatgaagtg gagctggggg agctgcttct gtcactgaat tatctcccaa gtgctggcag actgaatgtt gatgtcattc gagccaagca acttcttcag acagatgtga gccaaggttc agaccccttt gtgaaaatcc agctggtgca tggactcaaa cttgtgaaaa ccaagaagac gtccttctta aggggcacaa ttgatccttt ctacaatgaa tccttcagct tcaaagttcc ccaagaagaa ctggaaaatg ccagcctagt gtttacagtt ttcggccaca acatgaagag cagcaatgac ttcatcggga ggatcgtcat tggccagtac tcttcaggcc cctctgagac caaccactgg aggcgcatgc tcaacacgca ccgcacagcc gtggagcagt ggcatagcct gaggtcccga gctgagtgtg accgcgtgtc tcctgcctcc ctggaggtga cctga. It is sometimes possible for the material contained within the vial of "SYT17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
