Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT14 cdna clone

SYT14 cDNA Clone

Gene Names
SYT14; SCAR11; sytXIV
Synonyms
SYT14; SYT14 cDNA Clone; SYT14 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacttatctgtattagaaaagatagggtatttctctgtggccaggctggagtacagtggcaccatcttggctcactgcaacttccgcctcctgggttcaaacgattcttctgcctcagcatcccaagtaactgggactacagtatctccagaggcagttggatttttgtcagctgttggggtgtttattatcttgatgctgctcctttttctctatattaataagaagttctgttttgaaaatgttggcgggtttccagatcttggttcagaatacagtacaaggaagaattcacaagataaaatttataattcctacatggacaaagatgagcatggttcatcctctgaaagtgaagatgaagcgctgggtaaatatcatgaggccttatccagaacacacaattccagactaccactggcagattctagacaaaggaactatgcttgggaaacaaggcagaaatacagtcctctatcggcagagtatgatggatacagtagtgaagcatcaatagatgaaggaaactgcattcagagaatgagaagaacacccccgctggatgaattgcagccaccaccatatcaggatgacagtggttctccccatctgtcatgtacaccctcagaaattggggacagtaaatgtgaattttcccactgcagcaacagtccaagatgctcatataacaagtgcccaagtgaaggaagcacaggtcatgaaatagaaagttttcataataaaggatatgaagaagatgttccaagtgacagcactgcagtcctgagccctgaagatatgtcagctcaaggatcatcttcgcagcttcctaaaccttttgatcctgagccagaagctaaatatggcacactggatgtgacttttgactatgactcacaagaacagaagcttctggtaacagtgacagctgtcacagacatcccaacatataacaggacaggtggcaactcatggcaagtacaccttgttcttctacctataaagaaacagagagcaaaaaccagcatccagagaggaccatgccctgtcttcacagaaacatttaaatttaatcatgttgaatctgagatgattggaaattatgcagttcggtttagactgtatggtgtacatcgcatgaaaaaagaaaagattgtgggggaaaagattttttatttaacaaaattgaatcttcaagggaaaatgtcattgcctgtgatattggaaccttcttacaatcattctggctgtgactcccaaatgagcgtgtcagaaatgtcgtgtagtgaaagtacatcctcatgtcagtctcttgaacatggctcagttccagaaattcttattggcctgctttataatgccacaactggaagactatcagcagaagtgataaaaggcagccacttcaaaaatttggcagcaaacagaccacccaatggactgttctgttgtctaaaacacttgataggtggacaggtttatataatccgagatacatatgttaagttaactctactgaattccatgggtcaagagatgtccaaatgcaagacatccatccgcagagggcagccaaatccagtatataaggaaacttttgtctttcaagtggccctatttcagctttctgatgtgacactcatactgtctgtgtataacaaacgcagcatgaaaagaaaagagatgataggctggatttctttaggtctcaacagctctggagaagaagaactcaatcactggactgaaatgaaagagtcaaaaggacagcaagtatgtagatggcatgcgttgctagagtcatga
Sequence Length
1809
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,346 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XIV, mRNA
NCBI Official Synonym Full Names
synaptotagmin 14
NCBI Official Symbol
SYT14
NCBI Official Synonym Symbols
SCAR11; sytXIV
NCBI Protein Information
synaptotagmin-14
UniProt Protein Name
Synaptotagmin-14
Protein Family
UniProt Gene Name
SYT14
UniProt Synonym Gene Names
SytXIV
UniProt Entry Name
SYT14_HUMAN

NCBI Description

This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate membrane trafficking in synaptic transmission. The encoded protein is a calcium-independent synaptotagmin. Mutations in this gene are a cause of autosomal recessive spinocerebellar ataxia-11 (SCAR11), and a t(1;3) translocation of this gene has been associated with neurodevelopmental abnormalities. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Dec 2011]

Uniprot Description

SYT14: May be involved in the trafficking and exocytosis of secretory vesicles in non-neuronal tissues. Is Ca(2+)-independent. Defects in SYT14 are the cause of spinocerebellar ataxia autosomal recessive type 11 (SCAR11). Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCAR11 is associated with psychomotor retardation. Belongs to the synaptotagmin family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q32.2

Cellular Component: plasma membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; vesicle fusion

Disease: Spinocerebellar Ataxia, Autosomal Recessive 11

Research Articles on SYT14

Similar Products

Product Notes

The SYT14 syt14 (Catalog #AAA1276478) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacttat ctgtattaga aaagataggg tatttctctg tggccaggct ggagtacagt ggcaccatct tggctcactg caacttccgc ctcctgggtt caaacgattc ttctgcctca gcatcccaag taactgggac tacagtatct ccagaggcag ttggattttt gtcagctgtt ggggtgttta ttatcttgat gctgctcctt tttctctata ttaataagaa gttctgtttt gaaaatgttg gcgggtttcc agatcttggt tcagaataca gtacaaggaa gaattcacaa gataaaattt ataattccta catggacaaa gatgagcatg gttcatcctc tgaaagtgaa gatgaagcgc tgggtaaata tcatgaggcc ttatccagaa cacacaattc cagactacca ctggcagatt ctagacaaag gaactatgct tgggaaacaa ggcagaaata cagtcctcta tcggcagagt atgatggata cagtagtgaa gcatcaatag atgaaggaaa ctgcattcag agaatgagaa gaacaccccc gctggatgaa ttgcagccac caccatatca ggatgacagt ggttctcccc atctgtcatg tacaccctca gaaattgggg acagtaaatg tgaattttcc cactgcagca acagtccaag atgctcatat aacaagtgcc caagtgaagg aagcacaggt catgaaatag aaagttttca taataaagga tatgaagaag atgttccaag tgacagcact gcagtcctga gccctgaaga tatgtcagct caaggatcat cttcgcagct tcctaaacct tttgatcctg agccagaagc taaatatggc acactggatg tgacttttga ctatgactca caagaacaga agcttctggt aacagtgaca gctgtcacag acatcccaac atataacagg acaggtggca actcatggca agtacacctt gttcttctac ctataaagaa acagagagca aaaaccagca tccagagagg accatgccct gtcttcacag aaacatttaa atttaatcat gttgaatctg agatgattgg aaattatgca gttcggttta gactgtatgg tgtacatcgc atgaaaaaag aaaagattgt gggggaaaag attttttatt taacaaaatt gaatcttcaa gggaaaatgt cattgcctgt gatattggaa ccttcttaca atcattctgg ctgtgactcc caaatgagcg tgtcagaaat gtcgtgtagt gaaagtacat cctcatgtca gtctcttgaa catggctcag ttccagaaat tcttattggc ctgctttata atgccacaac tggaagacta tcagcagaag tgataaaagg cagccacttc aaaaatttgg cagcaaacag accacccaat ggactgttct gttgtctaaa acacttgata ggtggacagg tttatataat ccgagataca tatgttaagt taactctact gaattccatg ggtcaagaga tgtccaaatg caagacatcc atccgcagag ggcagccaaa tccagtatat aaggaaactt ttgtctttca agtggcccta tttcagcttt ctgatgtgac actcatactg tctgtgtata acaaacgcag catgaaaaga aaagagatga taggctggat ttctttaggt ctcaacagct ctggagaaga agaactcaat cactggactg aaatgaaaga gtcaaaagga cagcaagtat gtagatggca tgcgttgcta gagtcatga. It is sometimes possible for the material contained within the vial of "SYT14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.