Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYT12 cdna clone

SYT12 cDNA Clone

Synonyms
SYT12; SYT12 cDNA Clone; SYT12 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtggatgtggcagaataccatctgagcgtcatcaagagcccccctggctgggaggtgggtgtctatgctgcaggggccctggccctgctgggaatcgcagctgtgagcctgtggaagctctggacgtcggggagcttccccagcccctctccgttccccaattacgactacaggtaccttcagcagaagtacggcgagagctgcgcagaggccagggagaagagagtgcctgcctggaatgcccagcgggccagcacgcggggaccacccagccgcaaaggcagtctcagcattgaggacacctttgagagcatcagtgaactggggcctctggagctgatgggccgggagttggacctggccccctatgggaccctccggaagtcccagtcggccgactccctgaactccatctcctccgtgagcaacacctttgggcaggacttcacactgggccaggtggaggtgagcatggagtacgacactgcctcccacacgctgaacgtggcggtgatgcagggcaaggacctcctggagcgggaggaggccagcttcgagtcctgcttcatgcgcgtcagcctgctgccggacgagcagatcgtgggcatttctcggatccagagaaatgcctactccatcttctttgatgagaagttctccatccccctggatcccacagccctggaggagaagagcctgcggttttctgtatttggcatcgatgaggatgagcgcaacgtcagcacgggggtggtggagctgaagctttctgtgcttgacctcccgctgcagcccttcagtggctggctctatttacaggaccagaacaaggccgccgatgctgtgggggagatcctgctctccctcagctacctccccacagccgagcgcctcaccgtggtcgtggttaaggccaagaacctcatctggaccaacgacaagaccacagcggaccccttcgtcaaggtgtacctgctgcaggatgggaggaagatgagcaaaaagaagacagccgtgaagagggatgaccccaacccggtgttcaacgaagccatgatcttctcggtgccagccattgtgctccaggacctgtctctccgcgtgacggtggctgagagcagcagcgacggccgtggggacaacgtgggccatgtcatcattgggccgtcagccagtggcatgggaaccacacattggaaccagatgttggccacgctgcgcaggcccgtgtccatgtggcacgctgtccggcgaaactag
Sequence Length
1266
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,537 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XII, mRNA
UniProt Protein Name
Synaptotagmin-12
Protein Family
UniProt Gene Name
SYT12
UniProt Synonym Gene Names
SytXII
UniProt Entry Name
SYT12_HUMAN

Uniprot Description

SYT12: May be involved in Ca(2+)-dependent exocytosis of secretory vesicles through Ca(2+) and phospholipid binding to the C2 domain or may serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Belongs to the synaptotagmin family.

Protein type: Membrane protein, integral; Vesicle

Chromosomal Location of Human Ortholog: 11q13.2

Cellular Component: plasma membrane; synaptic vesicle membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; syntaxin binding

Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; synaptic vesicle endocytosis; vesicle fusion

Similar Products

Product Notes

The SYT12 syt12 (Catalog #AAA1278961) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgg atgtggcaga ataccatctg agcgtcatca agagcccccc tggctgggag gtgggtgtct atgctgcagg ggccctggcc ctgctgggaa tcgcagctgt gagcctgtgg aagctctgga cgtcggggag cttccccagc ccctctccgt tccccaatta cgactacagg taccttcagc agaagtacgg cgagagctgc gcagaggcca gggagaagag agtgcctgcc tggaatgccc agcgggccag cacgcgggga ccacccagcc gcaaaggcag tctcagcatt gaggacacct ttgagagcat cagtgaactg gggcctctgg agctgatggg ccgggagttg gacctggccc cctatgggac cctccggaag tcccagtcgg ccgactccct gaactccatc tcctccgtga gcaacacctt tgggcaggac ttcacactgg gccaggtgga ggtgagcatg gagtacgaca ctgcctccca cacgctgaac gtggcggtga tgcagggcaa ggacctcctg gagcgggagg aggccagctt cgagtcctgc ttcatgcgcg tcagcctgct gccggacgag cagatcgtgg gcatttctcg gatccagaga aatgcctact ccatcttctt tgatgagaag ttctccatcc ccctggatcc cacagccctg gaggagaaga gcctgcggtt ttctgtattt ggcatcgatg aggatgagcg caacgtcagc acgggggtgg tggagctgaa gctttctgtg cttgacctcc cgctgcagcc cttcagtggc tggctctatt tacaggacca gaacaaggcc gccgatgctg tgggggagat cctgctctcc ctcagctacc tccccacagc cgagcgcctc accgtggtcg tggttaaggc caagaacctc atctggacca acgacaagac cacagcggac cccttcgtca aggtgtacct gctgcaggat gggaggaaga tgagcaaaaa gaagacagcc gtgaagaggg atgaccccaa cccggtgttc aacgaagcca tgatcttctc ggtgccagcc attgtgctcc aggacctgtc tctccgcgtg acggtggctg agagcagcag cgacggccgt ggggacaacg tgggccatgt catcattggg ccgtcagcca gtggcatggg aaccacacat tggaaccaga tgttggccac gctgcgcagg cccgtgtcca tgtggcacgc tgtccggcga aactag. It is sometimes possible for the material contained within the vial of "SYT12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.