Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYNC cdna clone

SYNC cDNA Clone

Gene Names
SYNC; SYNC1; SYNCOILIN
Synonyms
SYNC; SYNC cDNA Clone; SYNC cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAGGAACCTGGAGGACCAGATCGCACTTGTGAGGCAAAAACGAGATGAAGAGGTGCAGCAGTACAGGGAACAGCTGGAGGAAATGGAAGAACGCCAGAGGCAGTTAAGAAATGGGGTGCAACTCCAGCAACAGAAGAACAAAGAGATGGAACAGCTAAGGCTCAGTCTTGCTGAAGAGCTCTCTACTTATAAGGCTATGCTACTACCCAAGAGCCTGGAACAGGCTGATGCTCCCACTTCTCAGGCAGGTGGAATGGAGACACAGTCTCAAGGGGCTGTTTAG
Sequence Length
456
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,947 Da
NCBI Official Full Name
Homo sapiens syncoilin, intermediate filament protein, mRNA
NCBI Official Synonym Full Names
syncoilin, intermediate filament protein
NCBI Official Symbol
SYNC
NCBI Official Synonym Symbols
SYNC1; SYNCOILIN
NCBI Protein Information
syncoilin
UniProt Protein Name
Syncoilin
Protein Family
UniProt Gene Name
SYNC
UniProt Synonym Gene Names
SYNC1
UniProt Entry Name
SYNCI_HUMAN

NCBI Description

This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]

Uniprot Description

SYNC1: a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]

Chromosomal Location of Human Ortholog: 1p35.1

Research Articles on SYNC

Similar Products

Product Notes

The SYNC sync (Catalog #AAA1270300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCAGAGA GCCGCCAGGA CCTGGAGGAG GAGTATGAGC CTCAGTTCCT GCGGCTCCTA GAGAGGAAAG AAGCTGGGAC CAAAGCTCTG CAGAGAACCC AGGCTGAGAT CCAGGAAATG AAGGAGGCTC TGAGACCCCT GCAAGCAGAG GCCCGGCAGC TCCGCCTGCA AAACAGGAAC CTGGAGGACC AGATCGCACT TGTGAGGCAA AAACGAGATG AAGAGGTGCA GCAGTACAGG GAACAGCTGG AGGAAATGGA AGAACGCCAG AGGCAGTTAA GAAATGGGGT GCAACTCCAG CAACAGAAGA ACAAAGAGAT GGAACAGCTA AGGCTCAGTC TTGCTGAAGA GCTCTCTACT TATAAGGCTA TGCTACTACC CAAGAGCCTG GAACAGGCTG ATGCTCCCAC TTCTCAGGCA GGTGGAATGG AGACACAGTC TCAAGGGGCT GTTTAG. It is sometimes possible for the material contained within the vial of "SYNC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.