SVOPL cdna clone
SVOPL cDNA Clone
Synonyms
SVOPL; SVOPL cDNA Clone; SVOPL cdna clone
Sequence
atggccgctggaaggttaatcataaagactgaatttttgcccacgaaataccgaggctatatgttacccttgtctcaggtgttctggcttgcgggctccctgctcatcattggcttggcctctgtgatcatccccaccatcgggtggcgctggctcattcgcgtcgcctccatcccgggcatcatcctcatcgtggccttcaagtttattcctgaatctgcccggttcaatgtctccactgggaacactcgggctgccctggccactctggagcgcgttgccaagatgaaccgctcggtcatgccggaggggaagctggtggagcccgtcctggaaaaaagaggaagatttgcagacctattggatgctaaatatttacggaccacattacagatctgggtcatatggcttggaatctcttttgcctactatggggttatcctggccagtgctgagctgctggagcgggacttggtctgtggttcaaagtcagactctgcggtggtggtgactgggggggactcaggggagagccagagcccctgctactgccacatgtttgcaccctctgactatcggaccatgatcatcagcaccatcggtgaaattgctttgaatcctttaaatatactgggcatcaatttcctgggaagacggctgagcctttctattaccatgggatgcacggctttattcttccttctcctcaacatttgcacttcaagtgccggcctgattggcttcctcttcatgctgagggctctggtagctgcaaacttcaacaccgtctacatttacacagctgaggtctaccccaccacgatgcgcgctttggggatgggaaccagcggctccctgtgtcgcattggtgcaatggtggcgccatttatatcccaggttcttatgagtgcatcaatactgggggccctgtgtctcttctcatctgtctgtgttgtatgcgccatttctgcattcactctccccatcgaaaccaaaggacgggccctccagcaaattaaatga
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,911 Da
NCBI Official Full Name
Homo sapiens SVOP-like, mRNA
NCBI Official Synonym Full Names
SVOP like
NCBI Official Symbol
SVOPL
NCBI Protein Information
putative transporter SVOPL
UniProt Protein Name
Putative transporter SVOPL
Protein Family
UniProt Gene Name
SVOPL
UniProt Entry Name
SVOPL_HUMAN
Uniprot Description
SVOPL: Belongs to the major facilitator superfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 7q34
Cellular Component: integral to membrane
Molecular Function: substrate-specific transmembrane transporter activity
Similar Products
Product Notes
The SVOPL svopl (Catalog #AAA1278662) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgctg gaaggttaat cataaagact gaatttttgc ccacgaaata ccgaggctat atgttaccct tgtctcaggt gttctggctt gcgggctccc tgctcatcat tggcttggcc tctgtgatca tccccaccat cgggtggcgc tggctcattc gcgtcgcctc catcccgggc atcatcctca tcgtggcctt caagtttatt cctgaatctg cccggttcaa tgtctccact gggaacactc gggctgccct ggccactctg gagcgcgttg ccaagatgaa ccgctcggtc atgccggagg ggaagctggt ggagcccgtc ctggaaaaaa gaggaagatt tgcagaccta ttggatgcta aatatttacg gaccacatta cagatctggg tcatatggct tggaatctct tttgcctact atggggttat cctggccagt gctgagctgc tggagcggga cttggtctgt ggttcaaagt cagactctgc ggtggtggtg actggggggg actcagggga gagccagagc ccctgctact gccacatgtt tgcaccctct gactatcgga ccatgatcat cagcaccatc ggtgaaattg ctttgaatcc tttaaatata ctgggcatca atttcctggg aagacggctg agcctttcta ttaccatggg atgcacggct ttattcttcc ttctcctcaa catttgcact tcaagtgccg gcctgattgg cttcctcttc atgctgaggg ctctggtagc tgcaaacttc aacaccgtct acatttacac agctgaggtc taccccacca cgatgcgcgc tttggggatg ggaaccagcg gctccctgtg tcgcattggt gcaatggtgg cgccatttat atcccaggtt cttatgagtg catcaatact gggggccctg tgtctcttct catctgtctg tgttgtatgc gccatttctg cattcactct ccccatcgaa accaaaggac gggccctcca gcaaattaaa tga. It is sometimes possible for the material contained within the vial of "SVOPL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
