Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SVOP cdna clone

SVOP cDNA Clone

Synonyms
SVOP; SVOP cDNA Clone; SVOP cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaggacttattccagctaaggcagctgccggttgtgaaattccgtcgcacaggcgagagtgcaaggtcagaggacgacacggcttcaggagagcatgaagtccagattgaaggggtccacgtgggcctagaggctgtggagctggatgatggggcagctgtgcccaaggagtttgccaatcccactgatgatactttcatggtggaagatgcagtggaagccattggctttggaaaatttcagtggaagctgtctgttctcactggcttggcttggatggctgatgccatggagatgatgatcctcagcatcctggcaccacagctgcattgcgagtggaggctcccaagctggcaggtggcattgctgacctcggtggtctttgtaggcatgatgtccagctccacgctctggggaaatatctcagaccagtacggcaggaaaacagggctgaagatcagcgtgctgtggactctgtactatggcatccttagtgcatttgcgcccgtgtatagctggatcctggtgctccggggcctggtgggcttcgggatcggaggagttccccagtcggtgacgctgtatgccgagttccttcccatgaaagccagagctaaatgtattttgctgattgaggtattctgggccatcgggacagtgttcgaggtcgtcctggctgtgttcgtgatgcccagcctgggctggcgttggctgctcatcctctcagctgtcccgctcctcctctttgccgtgctgtgtttctggctgcctgaaagtgcaaggtatgatgtgctgtcagggaaccaggaaaaggcaatcgccaccttaaagaggatagcaactgaaaacggagctcccatgccgctggggaaactcatcatctccagacaggaagaccgaggcaaaatgagggaccttttcacaccccattttagatggacaactttgctgctgtggtttatatggttttccaatgcattctcttactacgggttagttctactcaccacagaactcttccaggcaggagatgtctgcggcatctccagtcggaagaaggctgtagaggcaaaatgcagcctggcctgcgagtacctgagtgaggaggattacatggacttgctgtggaccaccctctctgagtttccaggtgtccttgtgactctgtggattattgaccgcctggggcgcaagaagaccatggccctgtgctttgtcatcttctccttctgcagcctcctgctgtttatctgtgttggaagaaatgtgctcactctgttactcttcattgcaagagcgtttatttctggaggctttcaagcggcatatgtttacacacctgaggtctaccccacggcaacgcgggccctcggcctgggcacctgcagcggcatggcaagagtgggtgctctcatcactccgttcatcgcccaggtgatgctggaatcctctgtgtacctgactctggcagtttacagtggctgctgcctcctggctgccctggcctcctgctttttgcccattgagaccaaaggccgaggactgcaggagtccagccaccgggagtggggccaggagatggtcggccgaggaatgcacggtgcaggtgttaccaggtcgaactctggctctcaggaatag
Sequence Length
1647
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,769 Da
NCBI Official Full Name
Homo sapiens SV2 related protein homolog (rat), mRNA
NCBI Official Synonym Full Names
SV2 related protein
NCBI Official Symbol
SVOP
NCBI Protein Information
synaptic vesicle 2-related protein
UniProt Protein Name
Synaptic vesicle 2-related protein
UniProt Gene Name
SVOP
UniProt Synonym Gene Names
SV2-related protein
UniProt Entry Name
SVOP_HUMAN

Uniprot Description

SVOP: Belongs to the major facilitator superfamily.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q24.11

Cellular Component: integral to membrane; synaptic vesicle

Molecular Function: substrate-specific transmembrane transporter activity

Similar Products

Product Notes

The SVOP svop (Catalog #AAA1265755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg acttattcca gctaaggcag ctgccggttg tgaaattccg tcgcacaggc gagagtgcaa ggtcagagga cgacacggct tcaggagagc atgaagtcca gattgaaggg gtccacgtgg gcctagaggc tgtggagctg gatgatgggg cagctgtgcc caaggagttt gccaatccca ctgatgatac tttcatggtg gaagatgcag tggaagccat tggctttgga aaatttcagt ggaagctgtc tgttctcact ggcttggctt ggatggctga tgccatggag atgatgatcc tcagcatcct ggcaccacag ctgcattgcg agtggaggct cccaagctgg caggtggcat tgctgacctc ggtggtcttt gtaggcatga tgtccagctc cacgctctgg ggaaatatct cagaccagta cggcaggaaa acagggctga agatcagcgt gctgtggact ctgtactatg gcatccttag tgcatttgcg cccgtgtata gctggatcct ggtgctccgg ggcctggtgg gcttcgggat cggaggagtt ccccagtcgg tgacgctgta tgccgagttc cttcccatga aagccagagc taaatgtatt ttgctgattg aggtattctg ggccatcggg acagtgttcg aggtcgtcct ggctgtgttc gtgatgccca gcctgggctg gcgttggctg ctcatcctct cagctgtccc gctcctcctc tttgccgtgc tgtgtttctg gctgcctgaa agtgcaaggt atgatgtgct gtcagggaac caggaaaagg caatcgccac cttaaagagg atagcaactg aaaacggagc tcccatgccg ctggggaaac tcatcatctc cagacaggaa gaccgaggca aaatgaggga ccttttcaca ccccatttta gatggacaac tttgctgctg tggtttatat ggttttccaa tgcattctct tactacgggt tagttctact caccacagaa ctcttccagg caggagatgt ctgcggcatc tccagtcgga agaaggctgt agaggcaaaa tgcagcctgg cctgcgagta cctgagtgag gaggattaca tggacttgct gtggaccacc ctctctgagt ttccaggtgt ccttgtgact ctgtggatta ttgaccgcct ggggcgcaag aagaccatgg ccctgtgctt tgtcatcttc tccttctgca gcctcctgct gtttatctgt gttggaagaa atgtgctcac tctgttactc ttcattgcaa gagcgtttat ttctggaggc tttcaagcgg catatgttta cacacctgag gtctacccca cggcaacgcg ggccctcggc ctgggcacct gcagcggcat ggcaagagtg ggtgctctca tcactccgtt catcgcccag gtgatgctgg aatcctctgt gtacctgact ctggcagttt acagtggctg ctgcctcctg gctgccctgg cctcctgctt tttgcccatt gagaccaaag gccgaggact gcaggagtcc agccaccggg agtggggcca ggagatggtc ggccgaggaa tgcacggtgc aggtgttacc aggtcgaact ctggctctca ggaatag. It is sometimes possible for the material contained within the vial of "SVOP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.