Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SUV39H1 cdna clone

SUV39H1 cDNA Clone

Gene Names
SUV39H1; MG44; KMT1A; SUV39H; H3-K9-HMTase 1
Synonyms
SUV39H1; SUV39H1 cDNA Clone; SUV39H1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaaaatttaaaaggctgcagcgtgtgttgcaagtcttcttggaatcagctgcaggacctgtgccgcctggccaagctctcctgccctgccctcggtatctctaagaggaacctctatgactttgaagtcgagtacctgtgcgattacaagaagatccgcgaacaggaatattacctggtgaaatggcgtggatatccagactcagagagcacctgggagccacggcagaatctcaagtgtgtgcgtatcctcaagcagttccacaaggacttagaaagggagctgctccggcggcaccaccggtcaaagaccccccggcacctggacccaagcttggccaactacctggtgcagaaggccaagcagaggcgggcgctccgtcgctgggagcaggagctcaatgccaagcgcagccatctgggacgcatcactgtagagaatgaggtggacctggacggccctccgcgggccttcgtgtacatcaatgagtaccgtgttggtgagggcatcaccctcaaccaggtggctgtgggctgcgagtgccaggactgtctgtgggcacccactggaggctgctgcccgggggcgtcactgcacaagtttgcctacaatgaccagggccaggtgcggcttcgagccgggctgcccatctacgagtgcaactcccgctgccgctgcggctatgactgcccaaatcgtgtggtacagaagggtatccgatatgacctctgcatcttccgcacggatgatgggcgtggctggggcgtccgcaccctggagaagattcgcaagaacagcttcgtcatggagtacgtgggagagatcattacctcagaggaggcagagcggcggggccagatctacgaccgtcagggcgccacctacctctttgacctggactacgtggaggacgtgtacaccgtggatgccgcctactatggcaacatctcccactttgtcaaccacagttgtgaccccaacctgcaggtgtacaacgtcttcatagacaaccttgacgagcggctgccccgcatcgctttctttgccacaagaaccatccgggcaggcgaggagctcacctttgattacaacatgcaagtggaccccgtggacatggagagcacccgcatggactccaactttggcctggctgggctccctggctcccctaagaagcgggtccgtattgaatgcaagtgtgggactgagtcctgccgcaaatacctcttctag
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,148 Da
NCBI Official Full Name
Homo sapiens suppressor of variegation 3-9 homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
suppressor of variegation 3-9 homolog 1
NCBI Official Symbol
SUV39H1
NCBI Official Synonym Symbols
MG44; KMT1A; SUV39H; H3-K9-HMTase 1
NCBI Protein Information
histone-lysine N-methyltransferase SUV39H1
UniProt Protein Name
Histone-lysine N-methyltransferase SUV39H1
UniProt Gene Name
SUV39H1
UniProt Synonym Gene Names
KMT1A; SUV39H; H3-K9-HMTase 1; Su(var)3-9 homolog 1
UniProt Entry Name
SUV91_HUMAN

NCBI Description

This gene encodes an evolutionarily-conserved protein containing an N-terminal chromodomain and a C-terminal SET domain. The encoded protein is a histone methyltransferase that trimethylates lysine 9 of histone H3, which results in transcriptional gene silencing. Loss of function of this gene disrupts heterochromatin formation and may cause chromosome instability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

SUV39H1: Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys- 9' as substrate. Also weakly methylates histone H1 (in vitro). H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as repression of MYOD1-stimulated differentiation, regulation of the control switch for exiting the cell cycle and entering differentiation, repression by the PML-RARA fusion protein, BMP-induced repression, repression of switch recombination to IgA and regulation of telomere length. Component of the eNoSC (energy-dependent nucleolar silencing) complex, a complex that mediates silencing of rDNA in response to intracellular energy status and acts by recruiting histone- modifying enzymes. The eNoSC complex is able to sense the energy status of cell: upon glucose starvation, elevation of NAD(+)/NADP(+) ratio activates SIRT1, leading to histone H3 deacetylation followed by dimethylation of H3 at 'Lys-9' (H3K9me2) by SUV39H1 and the formation of silent chromatin in the rDNA locus. Interacts with H3 and H4 histones. Interacts with GFI1B, DNMT3B, CBX1, CBX4, KIAA1967/DBC1, MBD1, RUNX1, RUNX3, MYOD1, SMAD5 and RB1. Interacts with SBF1 through the SET domain. Interacts with HDAC1 and HDAC2 through the N-terminus and associates with the core histone deacetylase complex composed of HDAC1, HDAC2, RBBP4 and RBBP7. Component of the eNoSC complex, composed of SIRT1, SUV39H1 and RRP8. In case of infection, interacts with HTLV-1 Tax protein, leading to abrogate Tax transactivation of HTLV-1 LTR. Interacts (via SET domain) with MECOM; enhances MECOM transcriptional repression activity. Inhibited by S-adenosyl-L-homocysteine. Negatively regulated by KIAA1967/DBC1. Belongs to the histone-lysine methyltransferase family. Suvar3-9 subfamily.

Protein type: Amino Acid Metabolism - lysine degradation; EC 2.1.1.43; Methyltransferase; Methyltransferase, protein lysine

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: chromatin silencing complex; condensed nuclear chromosome; heterochromatin; nucleoplasm; nucleus

Molecular Function: chromatin binding; histone lysine N-methyltransferase activity (H3-K9 specific); histone methyltransferase activity; histone-lysine N-methyltransferase activity; protein binding; protein N-terminus binding; S-adenosylmethionine-dependent methyltransferase activity

Biological Process: chromatin silencing at rDNA; establishment and/or maintenance of chromatin architecture; negative regulation of circadian rhythm; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; response to DNA damage stimulus

Research Articles on SUV39H1

Similar Products

Product Notes

The SUV39H1 suv39h1 (Catalog #AAA1272491) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaaa atttaaaagg ctgcagcgtg tgttgcaagt cttcttggaa tcagctgcag gacctgtgcc gcctggccaa gctctcctgc cctgccctcg gtatctctaa gaggaacctc tatgactttg aagtcgagta cctgtgcgat tacaagaaga tccgcgaaca ggaatattac ctggtgaaat ggcgtggata tccagactca gagagcacct gggagccacg gcagaatctc aagtgtgtgc gtatcctcaa gcagttccac aaggacttag aaagggagct gctccggcgg caccaccggt caaagacccc ccggcacctg gacccaagct tggccaacta cctggtgcag aaggccaagc agaggcgggc gctccgtcgc tgggagcagg agctcaatgc caagcgcagc catctgggac gcatcactgt agagaatgag gtggacctgg acggccctcc gcgggccttc gtgtacatca atgagtaccg tgttggtgag ggcatcaccc tcaaccaggt ggctgtgggc tgcgagtgcc aggactgtct gtgggcaccc actggaggct gctgcccggg ggcgtcactg cacaagtttg cctacaatga ccagggccag gtgcggcttc gagccgggct gcccatctac gagtgcaact cccgctgccg ctgcggctat gactgcccaa atcgtgtggt acagaagggt atccgatatg acctctgcat cttccgcacg gatgatgggc gtggctgggg cgtccgcacc ctggagaaga ttcgcaagaa cagcttcgtc atggagtacg tgggagagat cattacctca gaggaggcag agcggcgggg ccagatctac gaccgtcagg gcgccaccta cctctttgac ctggactacg tggaggacgt gtacaccgtg gatgccgcct actatggcaa catctcccac tttgtcaacc acagttgtga ccccaacctg caggtgtaca acgtcttcat agacaacctt gacgagcggc tgccccgcat cgctttcttt gccacaagaa ccatccgggc aggcgaggag ctcacctttg attacaacat gcaagtggac cccgtggaca tggagagcac ccgcatggac tccaactttg gcctggctgg gctccctggc tcccctaaga agcgggtccg tattgaatgc aagtgtggga ctgagtcctg ccgcaaatac ctcttctag. It is sometimes possible for the material contained within the vial of "SUV39H1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.