Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SURF1 cdna clone

SURF1 cDNA Clone

Gene Names
SURF1; CMT4K
Synonyms
SURF1; SURF1 cDNA Clone; SURF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggtggctgcgttgcagctggggctgcgggcggcggggctgggacgggccccggccagcgccgcctggaggagcgtcctcagggtctccccgcgcccaggggtggcctggaggccaagcagatgtggcagttctgcagcagaagcatctgccacaaaagcggaagatgactcctttcttcagtgggtcctgctcctcatccctgtgactgcctttggcttggggacatggcaggtccagcgtcggaagtggaagctgaacctgattgcagagttggagtccagagttctggctgagcctgtccctctgccagccgatccaatggaactgaaaaatctggagtataggccagtgaaggtcagggggtgctttgaccattccaaggagctgtatatgatgccccggaccatggtggaccctgtccgggaggcccgggagggcggcctcatctcctcctcaactcagagtggggcctatgtggtcactcccttccactgcaccgacctgggagtcaccatcctggtaaatagagggttcgttcccaggaagaaagtgaatcctgaaacccggcagaaaggccagattgagggagaagtggacctcattgggatggtgaggctgacagaaaccaggcagccttttgtccctgagaacaatccagaaaggaaccactggcattatcgagacctggaagctatggccagaatcacaggcgcagagcccatcttcattgatgccaacttccagagcacagtccctggaggacccattggagggcaaaccagagttactctgaggaacgagcatctgcagtacatcgtgacctggtatggactctctgcagctacatcctacctgtggtttaagaaattcctacgtgggacacctggtgtgtga
Sequence Length
903
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,979 Da
NCBI Official Full Name
Homo sapiens surfeit 1, mRNA
NCBI Official Synonym Full Names
SURF1, cytochrome c oxidase assembly factor
NCBI Official Symbol
SURF1
NCBI Official Synonym Symbols
CMT4K
NCBI Protein Information
surfeit locus protein 1
UniProt Protein Name
Surfeit locus protein 1
Protein Family
UniProt Gene Name
SURF1
UniProt Synonym Gene Names
SURF-1
UniProt Entry Name
SURF1_HUMAN

NCBI Description

This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]

Uniprot Description

SURF1: Probably involved in the biogenesis of the COX complex. Defects in SURF1 are a cause of Leigh syndrome (LS). LS is a severe neurological disorder characterized by bilaterally symmetrical necrotic lesions in subcortical brain regions that is commonly associated with systemic cytochrome c oxidase (COX) deficiency. Belongs to the SURF1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 9q34.2

Cellular Component: mitochondrial respiratory chain

Molecular Function: protein binding

Biological Process: aerobic respiration; ATP biosynthetic process; mitochondrial respiratory chain complex IV assembly; oxidative phosphorylation; respiratory chain complex IV assembly

Disease: Charcot-marie-tooth Disease, Type 4k; Leigh Syndrome

Research Articles on SURF1

Similar Products

Product Notes

The SURF1 surf1 (Catalog #AAA1277604) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg tggctgcgtt gcagctgggg ctgcgggcgg cggggctggg acgggccccg gccagcgccg cctggaggag cgtcctcagg gtctccccgc gcccaggggt ggcctggagg ccaagcagat gtggcagttc tgcagcagaa gcatctgcca caaaagcgga agatgactcc tttcttcagt gggtcctgct cctcatccct gtgactgcct ttggcttggg gacatggcag gtccagcgtc ggaagtggaa gctgaacctg attgcagagt tggagtccag agttctggct gagcctgtcc ctctgccagc cgatccaatg gaactgaaaa atctggagta taggccagtg aaggtcaggg ggtgctttga ccattccaag gagctgtata tgatgccccg gaccatggtg gaccctgtcc gggaggcccg ggagggcggc ctcatctcct cctcaactca gagtggggcc tatgtggtca ctcccttcca ctgcaccgac ctgggagtca ccatcctggt aaatagaggg ttcgttccca ggaagaaagt gaatcctgaa acccggcaga aaggccagat tgagggagaa gtggacctca ttgggatggt gaggctgaca gaaaccaggc agccttttgt ccctgagaac aatccagaaa ggaaccactg gcattatcga gacctggaag ctatggccag aatcacaggc gcagagccca tcttcattga tgccaacttc cagagcacag tccctggagg acccattgga gggcaaacca gagttactct gaggaacgag catctgcagt acatcgtgac ctggtatgga ctctctgcag ctacatccta cctgtggttt aagaaattcc tacgtgggac acctggtgtg tga. It is sometimes possible for the material contained within the vial of "SURF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.