Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SULT2B1 cdna clone

SULT2B1 cDNA Clone

Gene Names
SULT2B1; HSST2
Synonyms
SULT2B1; SULT2B1 cDNA Clone; SULT2B1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgggcccgccgagccccagatcccgggcttgtgggacacctatgaagatgacatctcggaaatcagccagaagttgccaggtgaatacttccggtacaagggcgtccccttccccgtcggcctgtactcgctcgagagcatcagcttggcggagaacacccaagatgtgcgggacgacgacatctttatcatcacctaccccaagtcaggcacgacctggatgatcgagatcatctgcttaatcctgaaggaaggggatccatcctggatccgctccgtgcccatctgggagcgggcaccctggtgtgagaccattgtgggtgccttcagcctcccggaccagtacagcccccgcctcatgagctcccatcttcccatccagatcttcaccaaggccttcttcagctccaaggccaaggtgatctacatgggccgcaacccccgggacgttgtggtctccctctatcattactccaagatcgccgggcagttaaaggacccgggcacacccgaccagttcctgagggacttcctcaaaggcgaagtgcagtttggctcctggttcgaccacattaagggctggcttcggatgaagggcaaagacaacttcctatttatcacctacgaggagctgcagcaggacttacagggctccgtggagcgcatctgtgggttcctgggccgtccgctgggcaaggaggcactgggctccgtcgtggcacactcaaccttcagcgccatgaaggccaacaccatgtccaactacacgctgctgcctcccagcctgctggaccaccgtcgcggggccttcctccggaaaggggtctgtggcgactggaagaaccacttcacggtggcccagagcgaagccttcgatcgtgcctaccgcaagcagatgcgggggatgccgaccttcccctgggatgaagacccggaggaggacggcagcccagatcctgagcccagccctgagcctgagcccaagcccagccttgagcccaacaccagcctggagcgtgagcccagacccaactccagccccagccccagccccggccaggcctctgagaccccgcacccacgaccctcataa
Sequence Length
1098
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,599 Da
NCBI Official Full Name
Homo sapiens sulfotransferase family, cytosolic, 2B, member 1, mRNA
NCBI Official Synonym Full Names
sulfotransferase family 2B member 1
NCBI Official Symbol
SULT2B1
NCBI Official Synonym Symbols
HSST2
NCBI Protein Information
sulfotransferase family cytosolic 2B member 1
UniProt Protein Name
Sulfotransferase family cytosolic 2B member 1
UniProt Gene Name
SULT2B1
UniProt Synonym Gene Names
HSST2; ST2B1; Sulfotransferase 2B1
UniProt Entry Name
ST2B1_HUMAN

NCBI Description

Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

SULT2B1: Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol, and isoform 2 avidly sulfonates pregnenolone but not cholesterol. Belongs to the sulfotransferase 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Energy Metabolism - sulfur; EC 2.8.2.2; Transferase; Lipid Metabolism - androgen and estrogen

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle

Molecular Function: alcohol sulfotransferase activity; protein binding; steroid sulfotransferase activity

Biological Process: 3'-phosphoadenosine 5'-phosphosulfate metabolic process; steroid metabolic process

Research Articles on SULT2B1

Similar Products

Product Notes

The SULT2B1 sult2b1 (Catalog #AAA1271013) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgggc ccgccgagcc ccagatcccg ggcttgtggg acacctatga agatgacatc tcggaaatca gccagaagtt gccaggtgaa tacttccggt acaagggcgt ccccttcccc gtcggcctgt actcgctcga gagcatcagc ttggcggaga acacccaaga tgtgcgggac gacgacatct ttatcatcac ctaccccaag tcaggcacga cctggatgat cgagatcatc tgcttaatcc tgaaggaagg ggatccatcc tggatccgct ccgtgcccat ctgggagcgg gcaccctggt gtgagaccat tgtgggtgcc ttcagcctcc cggaccagta cagcccccgc ctcatgagct cccatcttcc catccagatc ttcaccaagg ccttcttcag ctccaaggcc aaggtgatct acatgggccg caacccccgg gacgttgtgg tctccctcta tcattactcc aagatcgccg ggcagttaaa ggacccgggc acacccgacc agttcctgag ggacttcctc aaaggcgaag tgcagtttgg ctcctggttc gaccacatta agggctggct tcggatgaag ggcaaagaca acttcctatt tatcacctac gaggagctgc agcaggactt acagggctcc gtggagcgca tctgtgggtt cctgggccgt ccgctgggca aggaggcact gggctccgtc gtggcacact caaccttcag cgccatgaag gccaacacca tgtccaacta cacgctgctg cctcccagcc tgctggacca ccgtcgcggg gccttcctcc ggaaaggggt ctgtggcgac tggaagaacc acttcacggt ggcccagagc gaagccttcg atcgtgccta ccgcaagcag atgcggggga tgccgacctt cccctgggat gaagacccgg aggaggacgg cagcccagat cctgagccca gccctgagcc tgagcccaag cccagccttg agcccaacac cagcctggag cgtgagccca gacccaactc cagccccagc cccagccccg gccaggcctc tgagaccccg cacccacgac cctcataa. It is sometimes possible for the material contained within the vial of "SULT2B1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.