Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SULT1B1 cdna clone

SULT1B1 cDNA Clone

Gene Names
SULT1B1; ST1B1; ST1B2; SULT1B2
Synonyms
SULT1B1; SULT1B1 cDNA Clone; SULT1B1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctttccccaaaagatattctgcgaaaagatctgaagttggtccatggttatcccatgacctgtgcttttgcaagcaactgggaaaaaattgaacagttccatagcagaccagatgacattgtgatagccacttatcctaaatcaggtactacttgggttagtgaaattatagacatgattctaaatgatggagatattgaaaaatgtaagcgaggttttattactgaaaaagttccaatgttggaaatgactctccctggattaagaacatcaggtatagaacaattggagaagaatccatcaccccggattgtgaaaacacatctaccgactgatcttcttcctaaatctttctgggaaaacaattgcaagatgatttatctggctcgtaatgccaaggatgtttcagtctcatattaccattttgacttaatgaataatttacagccttttcctggtacctgggaagaatatctggagaaattcttaactggaaaagtggcctatggttcctggtttactcatgttaaaaactggtggaagagaaaggaagaacacccaatactttttttgtactatgaagatatgaaagagaatccaaaggaggaaatcaagaagatcattagatttctagagaagaacctgaatgatgagatcttggataggatcatccatcacacctcatttgaagtgatgaaggacaatcctttggtaaattatacacatctaccaactacagtgatggatcatagcaaatccccttttatgcgtaaagggacggctggtgactggaagaattacttcaccgtggcccaaaatgagaaatttgatgctatttatgagacagaaatgtccaaaactgcacttcaattccgcacagagatttaa
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,899 Da
NCBI Official Full Name
Homo sapiens sulfotransferase family, cytosolic, 1B, member 1, mRNA
NCBI Official Synonym Full Names
sulfotransferase family 1B member 1
NCBI Official Symbol
SULT1B1
NCBI Official Synonym Symbols
ST1B1; ST1B2; SULT1B2
NCBI Protein Information
sulfotransferase family cytosolic 1B member 1
UniProt Protein Name
Sulfotransferase family cytosolic 1B member 1
UniProt Gene Name
SULT1B1
UniProt Synonym Gene Names
ST1B2; SULT1B2; ST1B1; Sulfotransferase 1B1; ST1B2
UniProt Entry Name
ST1B1_HUMAN

NCBI Description

Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. However, the total genomic length of this gene is greater than that of other SULT1 genes. [provided by RefSeq, Jul 2008]

Uniprot Description

SULT1B1: Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine. Belongs to the sulfotransferase 1 family.

Protein type: EC 2.8.2.-; Transferase

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: cytosol

Molecular Function: aryl sulfotransferase activity; protein binding; sulfotransferase activity

Biological Process: 3'-phosphoadenosine 5'-phosphosulfate metabolic process; biogenic amine metabolic process; epithelial cell differentiation; flavonoid metabolic process; phenol metabolic process; sulfation; thyroid hormone metabolic process; xenobiotic metabolic process

Research Articles on SULT1B1

Similar Products

Product Notes

The SULT1B1 sult1b1 (Catalog #AAA1273912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctttccc caaaagatat tctgcgaaaa gatctgaagt tggtccatgg ttatcccatg acctgtgctt ttgcaagcaa ctgggaaaaa attgaacagt tccatagcag accagatgac attgtgatag ccacttatcc taaatcaggt actacttggg ttagtgaaat tatagacatg attctaaatg atggagatat tgaaaaatgt aagcgaggtt ttattactga aaaagttcca atgttggaaa tgactctccc tggattaaga acatcaggta tagaacaatt ggagaagaat ccatcacccc ggattgtgaa aacacatcta ccgactgatc ttcttcctaa atctttctgg gaaaacaatt gcaagatgat ttatctggct cgtaatgcca aggatgtttc agtctcatat taccattttg acttaatgaa taatttacag ccttttcctg gtacctggga agaatatctg gagaaattct taactggaaa agtggcctat ggttcctggt ttactcatgt taaaaactgg tggaagagaa aggaagaaca cccaatactt tttttgtact atgaagatat gaaagagaat ccaaaggagg aaatcaagaa gatcattaga tttctagaga agaacctgaa tgatgagatc ttggatagga tcatccatca cacctcattt gaagtgatga aggacaatcc tttggtaaat tatacacatc taccaactac agtgatggat catagcaaat ccccttttat gcgtaaaggg acggctggtg actggaagaa ttacttcacc gtggcccaaa atgagaaatt tgatgctatt tatgagacag aaatgtccaa aactgcactt caattccgca cagagattta a. It is sometimes possible for the material contained within the vial of "SULT1B1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.