Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SULT1A2 cdna clone

SULT1A2 cDNA Clone

Gene Names
SULT1A2; STP2; HAST4; P-PST; ST1A2; TSPST2
Synonyms
SULT1A2; SULT1A2 cDNA Clone; SULT1A2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctgatccaggacatctctcgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaggcccggcctgatgacctgctcatcagcacctaccccaagtccggcaccacctgggtgagccagattctggacatgatctaccagggcggtgacctggaaaagtgtcaccgagctcccatcttcatgcgggtgcccttccttgagttcaaagtcccagggattccctcagggatggagactctgaaaaacacaccagccccacgactcctgaagacacacctgcccctggctctgctcccccagactctgttggatcagaaggtcaaggtggtctatgttgcccgcaacgcaaaggatgtggcggtttcctactaccacttctaccacatggccaaagtgtaccctcaccctgggacctgggaaagcttcctggagaagttcatggctggagaagtgtcctatgggtcctggtaccagcacgtgcaagagtggtgggagctgagccgcacccaccctgttctctacctcttctatgaagacatgaaggagaaccccaaaagggagattcaaaagatcctggagtttgtggggcgctccctgccagaggagactgtggacctcatggttgagcacacgtcgttcaaggagatgaagaagaaccctatgaccaactacaccaccgtccgccgggagttcatggaccacagcatctcccccttcatgaggaaaggcatggctggggactggaagaccaccttcaccgtggcgcagaatgagcgcttcgatgcggactatgcggagaagatggcaggctgcagcctcagcttccgctctgagctgtga
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,310 Da
NCBI Official Full Name
Homo sapiens sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2, mRNA
NCBI Official Synonym Full Names
sulfotransferase family 1A member 2
NCBI Official Symbol
SULT1A2
NCBI Official Synonym Symbols
STP2; HAST4; P-PST; ST1A2; TSPST2
NCBI Protein Information
sulfotransferase 1A2
UniProt Protein Name
Sulfotransferase 1A2
Protein Family
UniProt Gene Name
SULT1A2
UniProt Synonym Gene Names
STP2; ST1A2; P-PST 2
UniProt Entry Name
ST1A2_HUMAN

NCBI Description

Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Two alternatively spliced variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

SULT1A2: Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of catecholamines, phenolic drugs and neurotransmitters. Is also responsible for the sulfonation and activation of minoxidil. Mediates the metabolic activation of carcinogenic N-hydroxyarylamines to DNA binding products and could so participate as modulating factor of cancer risk. Belongs to the sulfotransferase 1 family.

Protein type: Energy Metabolism - sulfur; Transferase; EC 2.8.2.1

Chromosomal Location of Human Ortholog: 16p12.1

Cellular Component: cytosol

Molecular Function: aryl sulfotransferase activity; flavonol 3-sulfotransferase activity; protein binding; sulfotransferase activity

Biological Process: 3'-phosphoadenosine 5'-phosphosulfate metabolic process; amine biosynthetic process; phenol metabolic process; sulfation; xenobiotic metabolic process

Research Articles on SULT1A2

Similar Products

Product Notes

The SULT1A2 sult1a2 (Catalog #AAA1267433) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctga tccaggacat ctctcgcccg ccactggagt acgtgaaggg ggtcccgctc atcaagtact ttgcagaggc actggggccc ctgcagagct tccaggcccg gcctgatgac ctgctcatca gcacctaccc caagtccggc accacctggg tgagccagat tctggacatg atctaccagg gcggtgacct ggaaaagtgt caccgagctc ccatcttcat gcgggtgccc ttccttgagt tcaaagtccc agggattccc tcagggatgg agactctgaa aaacacacca gccccacgac tcctgaagac acacctgccc ctggctctgc tcccccagac tctgttggat cagaaggtca aggtggtcta tgttgcccgc aacgcaaagg atgtggcggt ttcctactac cacttctacc acatggccaa agtgtaccct caccctggga cctgggaaag cttcctggag aagttcatgg ctggagaagt gtcctatggg tcctggtacc agcacgtgca agagtggtgg gagctgagcc gcacccaccc tgttctctac ctcttctatg aagacatgaa ggagaacccc aaaagggaga ttcaaaagat cctggagttt gtggggcgct ccctgccaga ggagactgtg gacctcatgg ttgagcacac gtcgttcaag gagatgaaga agaaccctat gaccaactac accaccgtcc gccgggagtt catggaccac agcatctccc ccttcatgag gaaaggcatg gctggggact ggaagaccac cttcaccgtg gcgcagaatg agcgcttcga tgcggactat gcggagaaga tggcaggctg cagcctcagc ttccgctctg agctgtga. It is sometimes possible for the material contained within the vial of "SULT1A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.