SUCNR1 cdna clone
SUCNR1 cDNA Clone
Gene Names
SUCNR1; GPR91
Synonyms
SUCNR1; SUCNR1 cDNA Clone; SUCNR1 cdna clone
Sequence
atgctggggatcatggcatggaatgcaacttgcaaaaactggctggcagcagaggctgccctggaaaagtactacctttccattttttatgggattgagttcgttgtgggagtccttggaaataccattgttgtttacggctacatcttctctctgaagaactggaacagcagtaatatttatctctttaacctctctgtctctgacttagcttttctgtgcaccctccccatgctgataaggagttatgccaatggaaactggatatatggagacgtgctctgcataagcaaccgatatgtgcttcatgccaacctctataccagcattctctttctcacttttatcagcatagatcgatacttgataattaagtatcctttccgagaacaccttctgcaaaagaaagagtttgctattttaatctccttggccatttgggttttagtaaccttagagttactacccatacttccccttataaatcctgttataactgacaatggcaccacctgtaatgattttgcaagttctggagaccccaactacaacctcatttacagcatgtgtctaacactgttggggttccttattcctctttttgtgatgtgtttcttttattacaagattgctctcttcctaaagcagaggaataggcaggttgctactgctctgccccttgaaaagcctctcaacttggtcatcatggcagtggtaatcttctctgtgctttttacaccctatcacgtcatgcggaatgtgaggatcgcttcacgcctggggagttggaagcagtatcagtgcactcaggtcgtcatcaactccttttacattgtgacacggcctttggcctttctgaacagtgtcatcaaccctgtcttctattttcttttgggagatcacttcagggacatgctgatgaatcaactgagacacaacttcaaatcccttacatcctttagcagatgggctcatgaactcctactttcattcagagaaaagtga
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,698 Da
NCBI Official Full Name
Homo sapiens succinate receptor 1, mRNA
NCBI Official Synonym Full Names
succinate receptor 1
NCBI Official Symbol
SUCNR1
NCBI Official Synonym Symbols
GPR91
NCBI Protein Information
succinate receptor 1
UniProt Protein Name
Succinate receptor 1
Protein Family
UniProt Gene Name
SUCNR1
UniProt Synonym Gene Names
GPR91
UniProt Entry Name
SUCR1_HUMAN
NCBI Description
This gene encodes a G-protein-coupled receptor for succinate, an intermediate molecule of the citric acid cycle. It is involved in the promotion of hematopoietic progenitor cell development, and it has a potential role in renovascular hypertension which has known correlations to renal failure, diabetes and atherosclerosis. [provided by RefSeq, Oct 2009]
Uniprot Description
SUCNR1: Receptor for succinate. Belongs to the G-protein coupled receptor 1 family.
Protein type: Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral; Receptor, GPCR
Chromosomal Location of Human Ortholog: 3q25.1
Cellular Component: plasma membrane
Research Articles on SUCNR1
Similar Products
Product Notes
The SUCNR1 sucnr1 (Catalog #AAA1268685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggga tcatggcatg gaatgcaact tgcaaaaact ggctggcagc agaggctgcc ctggaaaagt actacctttc cattttttat gggattgagt tcgttgtggg agtccttgga aataccattg ttgtttacgg ctacatcttc tctctgaaga actggaacag cagtaatatt tatctcttta acctctctgt ctctgactta gcttttctgt gcaccctccc catgctgata aggagttatg ccaatggaaa ctggatatat ggagacgtgc tctgcataag caaccgatat gtgcttcatg ccaacctcta taccagcatt ctctttctca cttttatcag catagatcga tacttgataa ttaagtatcc tttccgagaa caccttctgc aaaagaaaga gtttgctatt ttaatctcct tggccatttg ggttttagta accttagagt tactacccat acttcccctt ataaatcctg ttataactga caatggcacc acctgtaatg attttgcaag ttctggagac cccaactaca acctcattta cagcatgtgt ctaacactgt tggggttcct tattcctctt tttgtgatgt gtttctttta ttacaagatt gctctcttcc taaagcagag gaataggcag gttgctactg ctctgcccct tgaaaagcct ctcaacttgg tcatcatggc agtggtaatc ttctctgtgc tttttacacc ctatcacgtc atgcggaatg tgaggatcgc ttcacgcctg gggagttgga agcagtatca gtgcactcag gtcgtcatca actcctttta cattgtgaca cggcctttgg cctttctgaa cagtgtcatc aaccctgtct tctattttct tttgggagat cacttcaggg acatgctgat gaatcaactg agacacaact tcaaatccct tacatccttt agcagatggg ctcatgaact cctactttca ttcagagaaa agtga. It is sometimes possible for the material contained within the vial of "SUCNR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
