Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STRN3 cdna clone

STRN3 cDNA Clone

Gene Names
STRN3; SG2NA; PPP2R6B
Synonyms
STRN3; STRN3 cDNA Clone; STRN3 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgagcttgccggaggcggtggtggcggcccggggatggcggcccctccccggcagcagcagggacctggggggaacctgggcctttcgcccggggggaacggagcggcgggcggcgggggtcctccggcctccgagggagcgggtcccgcggcaggccccgagctgtcccggccgcagcagtacactatcccggggatactgcactacatccagcacgagtgggctcggttcgagatggagcgggcgcactgggaggtggaacgggccgaactgcaggcccggattgcatttctacaaggcgaaagaaaaggtcaagagaacctgaagaaggacttagtaagaagaataaagatgttagagtatgcattaaaacaagaaagggcaaaatatcacaaattaaaatatggcacggaactgaaccaaggtgacttgaaaatgccaacctttgagtcagaagaaaccaaagacacagaggctcccacagcacctcagaatagccagttaacgtggaagcaaggcagacagcttttaagacagtatcttcaggaagtaggttatacagatacaatattagatgtacggtctcagcgggtaaggtcattacttggactatctaattcagaaccaaatggatcagtagaaacaaagaatttagaacagatcctgaatggaggtgaatctcctaagcaaaagggacaagaaataaaaaggtcctctggtgatgttcttgagacgttcaatttcttagaaaatgccgatgacagtgatgaagatgaggaaaatgacatgatcgaaggcatcccagaaggaaaagacaaacatcggatgaataaacataaaataggtaatgaaggtttagctgctgacctaactgacgatcctgatactgaggaagcactgaaagaatttgattttttagtgactgctgaagatggtgaaggagctggagaagcacggagttcgggggatggcacagaatgggctgaaccaataacgtttccatctggaggaggcaagtcatttattatgggttctgatgatgttttgttaagtgtactgggccttggagaccttgcagacttgacggtaacaaatgatgcagactatagttatgatttgcctgctaataaagatgcctttcgaaagacatggaatcccaagtatacactacgtagccattttgatggagtacgggcattagcttttcatcctgtagaacctgtgctggttactgcttctgaggaccataccctgaaactttggaacctgcaaaaaacagttcctgccaaaaagagtgcctctttagatgtagagcctatctacacatttagggcccacatcggccctgttctgtcattagctattagttctaatggagaacagtgttttagtggtggtattgatgcaaccatccagtggtggaatatgccgagtcccagtgtagatccatatgatacatatgagccaaatgttctagctggcactttagttggtcatacagatgcagtttggggtcttgcttatagtggcataaaaaatcaattactgtcttgttcagcagatggcactgttaggttatggaatccacaagaaaaattgccatgtatttgcacttacaatggagataaaaagcatggaatacctacatcagttgactttataggctgtgatccagctcatatggtaacctctttcaacactggtagtgcagtaatttatgatttagaaacatcacagtcattggtgatactttcatcacaggtagattctggtttacaatctaataatcatatcaacagagtagtaagtcatcccacacttcctgttacaataactgctcatgaagatagacacatcaaattttttgacaataaaacgggtaaaatgatccattctatggtagctcacttggatgctgttacaagtctagcagtagatcctaatggaatctatttgatgtctggaagccatgactgttccatcagattatggaatttagacagcaagacatgtgtgcaagaaataacagctcacagaaagaaattggatgaatcaatttatgatgttgctttccactcgtcaaaagcatatatagctagtgcaggagctgatgctcttgccaaagtatttgtatga
Sequence Length
2142
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,745 Da
NCBI Official Full Name
Homo sapiens striatin, calmodulin binding protein 3, mRNA
NCBI Official Synonym Full Names
striatin 3
NCBI Official Symbol
STRN3
NCBI Official Synonym Symbols
SG2NA; PPP2R6B
NCBI Protein Information
striatin-3
UniProt Protein Name
Striatin-3
Protein Family
UniProt Gene Name
STRN3
UniProt Synonym Gene Names
GS2NA; SG2NA
UniProt Entry Name
STRN3_HUMAN

Uniprot Description

SG2NA: a protein of the WD-repeat striatin family. Mainly expressed within neurons and thought to act both as scaffolds and as Ca(2+)-dependent signalling proteins. May interact with protein phosphatase 2A. Two alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Transcription factor; Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 14q13-q21

Cellular Component: cell soma; dendrite; Golgi apparatus; nucleoplasm; plasma membrane; protein complex; protein phosphatase type 2A complex

Molecular Function: protein binding; protein complex binding; protein phosphatase 2A binding

Biological Process: negative regulation of estrogen receptor signaling pathway; response to estradiol stimulus

Research Articles on STRN3

Similar Products

Product Notes

The STRN3 strn3 (Catalog #AAA1273670) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagc ttgccggagg cggtggtggc ggcccgggga tggcggcccc tccccggcag cagcagggac ctggggggaa cctgggcctt tcgcccgggg ggaacggagc ggcgggcggc gggggtcctc cggcctccga gggagcgggt cccgcggcag gccccgagct gtcccggccg cagcagtaca ctatcccggg gatactgcac tacatccagc acgagtgggc tcggttcgag atggagcggg cgcactggga ggtggaacgg gccgaactgc aggcccggat tgcatttcta caaggcgaaa gaaaaggtca agagaacctg aagaaggact tagtaagaag aataaagatg ttagagtatg cattaaaaca agaaagggca aaatatcaca aattaaaata tggcacggaa ctgaaccaag gtgacttgaa aatgccaacc tttgagtcag aagaaaccaa agacacagag gctcccacag cacctcagaa tagccagtta acgtggaagc aaggcagaca gcttttaaga cagtatcttc aggaagtagg ttatacagat acaatattag atgtacggtc tcagcgggta aggtcattac ttggactatc taattcagaa ccaaatggat cagtagaaac aaagaattta gaacagatcc tgaatggagg tgaatctcct aagcaaaagg gacaagaaat aaaaaggtcc tctggtgatg ttcttgagac gttcaatttc ttagaaaatg ccgatgacag tgatgaagat gaggaaaatg acatgatcga aggcatccca gaaggaaaag acaaacatcg gatgaataaa cataaaatag gtaatgaagg tttagctgct gacctaactg acgatcctga tactgaggaa gcactgaaag aatttgattt tttagtgact gctgaagatg gtgaaggagc tggagaagca cggagttcgg gggatggcac agaatgggct gaaccaataa cgtttccatc tggaggaggc aagtcattta ttatgggttc tgatgatgtt ttgttaagtg tactgggcct tggagacctt gcagacttga cggtaacaaa tgatgcagac tatagttatg atttgcctgc taataaagat gcctttcgaa agacatggaa tcccaagtat acactacgta gccattttga tggagtacgg gcattagctt ttcatcctgt agaacctgtg ctggttactg cttctgagga ccataccctg aaactttgga acctgcaaaa aacagttcct gccaaaaaga gtgcctcttt agatgtagag cctatctaca catttagggc ccacatcggc cctgttctgt cattagctat tagttctaat ggagaacagt gttttagtgg tggtattgat gcaaccatcc agtggtggaa tatgccgagt cccagtgtag atccatatga tacatatgag ccaaatgttc tagctggcac tttagttggt catacagatg cagtttgggg tcttgcttat agtggcataa aaaatcaatt actgtcttgt tcagcagatg gcactgttag gttatggaat ccacaagaaa aattgccatg tatttgcact tacaatggag ataaaaagca tggaatacct acatcagttg actttatagg ctgtgatcca gctcatatgg taacctcttt caacactggt agtgcagtaa tttatgattt agaaacatca cagtcattgg tgatactttc atcacaggta gattctggtt tacaatctaa taatcatatc aacagagtag taagtcatcc cacacttcct gttacaataa ctgctcatga agatagacac atcaaatttt ttgacaataa aacgggtaaa atgatccatt ctatggtagc tcacttggat gctgttacaa gtctagcagt agatcctaat ggaatctatt tgatgtctgg aagccatgac tgttccatca gattatggaa tttagacagc aagacatgtg tgcaagaaat aacagctcac agaaagaaat tggatgaatc aatttatgat gttgctttcc actcgtcaaa agcatatata gctagtgcag gagctgatgc tcttgccaaa gtatttgtat ga. It is sometimes possible for the material contained within the vial of "STRN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.