Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STK4 cdna clone

STK4 cDNA Clone

Gene Names
STK4; KRS2; MST1; YSK3
Synonyms
STK4; STK4 cDNA Clone; STK4 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacggtacagctgaggaacccgccgcgccggcagctgaaaaagttggatgaagatagtttaaccaaacaaccagaagaagtatttgatgtcttagagaaacttggagaagggtga
Sequence Length
120
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,335 Da
NCBI Official Full Name
Homo sapiens serine/threonine kinase 4, mRNA
NCBI Official Synonym Full Names
serine/threonine kinase 4
NCBI Official Symbol
STK4
NCBI Official Synonym Symbols
KRS2; MST1; YSK3
NCBI Protein Information
serine/threonine-protein kinase 4
UniProt Protein Name
Serine/threonine-protein kinase 4
UniProt Gene Name
STK4
UniProt Synonym Gene Names
KRS2; MST1; MST-1; MST1/N; MST1/C
UniProt Entry Name
STK4_HUMAN

NCBI Description

The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]

Uniprot Description

MST1: a protein kinase of the STE20 family. Proteolytically activated by caspase during apoptosis. Activated by apoptotic signals as well as other stress conditions. Full activation requires both phosphorylation and caspase-mediated cleavage. Phosphorylation at serine 327 of Mst1, which is close to the caspase-3 recognition site, inhibits caspase-mediated cleavage.

Protein type: Protein kinase, Ser/Thr (non-receptor); Autophagy; EC 2.7.11.1; Protein kinase, STE; Kinase, protein; STE group; STE20 family; MST subfamily

Chromosomal Location of Human Ortholog: 20q11.2-q13.2

Cellular Component: cytoplasm; cytosol; nucleus; protein complex

Molecular Function: ATP binding; identical protein binding; magnesium ion binding; protein binding; protein dimerization activity; protein homodimerization activity; protein kinase activity; protein serine/threonine kinase activator activity; protein serine/threonine kinase activity; receptor signaling protein serine/threonine kinase activity; transcription factor binding

Biological Process: apoptosis; cell morphogenesis; peptidyl-serine phosphorylation; positive regulation of apoptosis; positive regulation of peptidyl-serine phosphorylation; positive regulation of protein amino acid phosphorylation; positive regulation of protein binding; protein amino acid autophosphorylation; protein amino acid phosphorylation; protein stabilization; signal transduction

Disease: T-cell Immunodeficiency, Recurrent Infections, And Autoimmunity With Or Without Cardiac Malformations

Research Articles on STK4

Similar Products

Product Notes

The STK4 stk4 (Catalog #AAA1268407) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacgg tacagctgag gaacccgccg cgccggcagc tgaaaaagtt ggatgaagat agtttaacca aacaaccaga agaagtattt gatgtcttag agaaacttgg agaagggtga. It is sometimes possible for the material contained within the vial of "STK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.