Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STEAP3 cdna clone

STEAP3 cDNA Clone

Gene Names
STEAP3; STMP3; TSAP6; pHyde; AHMIO2; dudlin-2; dudulin-2
Synonyms
STEAP3; STEAP3 cDNA Clone; STEAP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagaagagatggacaagccactgatcagcctccacctggtggacagcgatagtagccttgccaaggtccccgatgaggcccccaaagtgggcatcctgggtagcggggactttgcccgctccctggccacacgcctggtgggctctggcttcaaagtggtggtggggagccgcaaccccaaacgcacagccaggctgtttccctcagcggcccaagtgactttccaagaggaggcagtgagctccccggaggtcatctttgtggctgtgttccgggagcactactcttcactgtgcagtctcagtgaccagctggcgggcaagatcctggtggatgtgagcaaccctacagagcaagagcaccttcagcatcgtgagtccaatgctgagtacctggcctccctcttccccacttgcacagtggtcaaggccttcaatgtcatctctgcctggaccctgcaggctggcccaagggatggtaacaggcaggtgcccatctgcggtgaccagccagaagccaagcgtgctgtctcggagatggcgctcgccatgggcttcatgcccgtggacatgggatccctggcgtcagcctgggaggtggaggccatgcccctgcgcctcctcccggcctggaaggtgcccaccctgctggccctggggctcttcgtctgcttctatgcctacaacttcgtccgggacgttctgcagccctatgtgcaggaaagccagaacaagttcttcaagctgcccgtgtccgtggtcaacaccacactgccgtgcgtggcctacgtgctgctgtcactcgtgtacttgcccggcgtgctggcggctgccctgcagctgcggcgcggcaccaagtaccagcgcttccccgactggctggaccactggctacagcaccgcaagcagatcgggctgctcagcttcttctgcgccgccctgcacgccctctacagcttctgcttgccgctgcgccgcgcccaccgctacgacctggtcaacctggcagtcaagcaggtcttggccaacaagagccacctctgggtggaggaggaggtctggcggatggagatctacctctccctgggagtgctggccctcggcacgttgtccctgctggccgtgacctcactgccgtccattgcaaactcgctcaactggagggagttcagcttcgttcagtcctcactgggctttgtggccctcgtgctgagcacactgcacacgctcacctacggctggacccgcgccttcgaggagagccgctacaagttctacctgcctcccaccttcacgctcacgctgctggtgccctgcgtcgtcatcctggccaaagccctgtttctcctgccctgcatcagccgcagactcgccaggatccggagaggctgggagagggagagcaccatcaagttcacgctgcccacagaccacgccctggccgagaagacgagccacgtatga
Sequence Length
1467
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,499 Da
NCBI Official Full Name
Homo sapiens STEAP family member 3, mRNA
NCBI Official Synonym Full Names
STEAP3 metalloreductase
NCBI Official Symbol
STEAP3
NCBI Official Synonym Symbols
STMP3; TSAP6; pHyde; AHMIO2; dudlin-2; dudulin-2
NCBI Protein Information
metalloreductase STEAP3
UniProt Protein Name
Metalloreductase STEAP3
Protein Family
UniProt Gene Name
STEAP3
UniProt Synonym Gene Names
TSAP6; hTSAP6; hpHyde
UniProt Entry Name
STEA3_HUMAN

NCBI Description

This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Uniprot Description

STEAP3: a multi-pass membrane protein induced directly by p53. Plays an important role in facilitating exosome secretion. Enhances secretion in the DNA damage-induced p53-dependent exosomal secretory pathway. Localizes to vesicular-like structures at the plasma membrane and around the nucleus. Highly expressed in hematopoietic tissues where it localizes to the specialized endosome. An endosomal ferrireductase required for efficient transferrin-dependent iron uptake in erythroid cells. Participates in erythroid iron homeostasis by reducing Fe(3+) to Fe(2+). Can also reduce of Cu(2+) to Cu(1+), suggesting that it participates in copper homeostasis. Uses NAD(+) as acceptor. Contains a highly-conserved tyrosine-based motif that has been shown to target transmembrane proteins, including LAMP-1, LAMP-2, the TfR, and SLC11A1 to endosomes, lysosomes, and lysosome-related organelles. Facilitates the exosomal secretion of proteins such as TCTP. Interacts with BNIP3L, MYT1 and TPT1. Four human isoforms are produced by alternative splicing. Isoform 4 is also known as pHyde II.

Protein type: Transporter, iron; Transporter, ion channel; EC 1.16.1.-; Oxidoreductase; Transporter; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 2q14.2

Cellular Component: cytoplasm; endosome membrane; integral to plasma membrane; multivesicular body

Molecular Function: cupric reductase activity; oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor; protein binding

Biological Process: copper ion import; protein secretion; regulation of apoptosis; transferrin transport

Disease: Anemia, Hypochromic Microcytic, With Iron Overload 2

Research Articles on STEAP3

Similar Products

Product Notes

The STEAP3 steap3 (Catalog #AAA1276712) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagaag agatggacaa gccactgatc agcctccacc tggtggacag cgatagtagc cttgccaagg tccccgatga ggcccccaaa gtgggcatcc tgggtagcgg ggactttgcc cgctccctgg ccacacgcct ggtgggctct ggcttcaaag tggtggtggg gagccgcaac cccaaacgca cagccaggct gtttccctca gcggcccaag tgactttcca agaggaggca gtgagctccc cggaggtcat ctttgtggct gtgttccggg agcactactc ttcactgtgc agtctcagtg accagctggc gggcaagatc ctggtggatg tgagcaaccc tacagagcaa gagcaccttc agcatcgtga gtccaatgct gagtacctgg cctccctctt ccccacttgc acagtggtca aggccttcaa tgtcatctct gcctggaccc tgcaggctgg cccaagggat ggtaacaggc aggtgcccat ctgcggtgac cagccagaag ccaagcgtgc tgtctcggag atggcgctcg ccatgggctt catgcccgtg gacatgggat ccctggcgtc agcctgggag gtggaggcca tgcccctgcg cctcctcccg gcctggaagg tgcccaccct gctggccctg gggctcttcg tctgcttcta tgcctacaac ttcgtccggg acgttctgca gccctatgtg caggaaagcc agaacaagtt cttcaagctg cccgtgtccg tggtcaacac cacactgccg tgcgtggcct acgtgctgct gtcactcgtg tacttgcccg gcgtgctggc ggctgccctg cagctgcggc gcggcaccaa gtaccagcgc ttccccgact ggctggacca ctggctacag caccgcaagc agatcgggct gctcagcttc ttctgcgccg ccctgcacgc cctctacagc ttctgcttgc cgctgcgccg cgcccaccgc tacgacctgg tcaacctggc agtcaagcag gtcttggcca acaagagcca cctctgggtg gaggaggagg tctggcggat ggagatctac ctctccctgg gagtgctggc cctcggcacg ttgtccctgc tggccgtgac ctcactgccg tccattgcaa actcgctcaa ctggagggag ttcagcttcg ttcagtcctc actgggcttt gtggccctcg tgctgagcac actgcacacg ctcacctacg gctggacccg cgccttcgag gagagccgct acaagttcta cctgcctccc accttcacgc tcacgctgct ggtgccctgc gtcgtcatcc tggccaaagc cctgtttctc ctgccctgca tcagccgcag actcgccagg atccggagag gctgggagag ggagagcacc atcaagttca cgctgcccac agaccacgcc ctggccgaga agacgagcca cgtatga. It is sometimes possible for the material contained within the vial of "STEAP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.